... GLOBAL SOIL CHANGE: TIME-SCALES AND RATES OF PEDOGENIC PROCESSES (GSC-MEXICO-2005) . With pre-and post-conference field trips Montecillo, Mexico, March 29-April 06, 2005 . ... Chairmen: Prof., Dr. Benjamin Figueroa Sandoval, Director Central, Colegio de Postgraduados, Montecillo, Texcoco, Mexico, e-mail: Benjamin@colpos.colpos.mx . ... I intend to participate in the International Conference "Global Soil Change: Time-scales and Rates of Pedogenic Processes" in Mexico, March 29 - April 06, 2005 . ...

Еще в разделе: (Показать все результаты (>189) - www.fadr.msu.ru/ )

... 15,45 * * * * (cd ~twiki/public_html/bin; ./mailnotify -q) . ... This will generate log entries in file twiki/data/log<date>.txt . ... The WebStatistics topic must be present in all webs where you want to have statistics. ... Call the twiki/bin/statistics script from a cron job, once a day is recommended. ... There is a workaround in case you can't run the script as user nobody : Run the utility twiki/bin/geturl in your cron job and specify the URL of the twiki/bin/statistics script as a parameter. ...

Еще в разделе: (Показать все результаты (>42069) - dualopt1.cmm.msu.ru/ )

• TWikiSiteTools - TWiki - TWiki

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>124) - www.intsys.msu.ru/ )

• Intelligent Systems :: Teaching :: Seminars :: Список специальных семинаров

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Science and education . ... Scientific Laboratories . ... Science . ... Main Science and education Scientific Laboratories Laboratory of Nonlinear Spectroscopy of Ultrafast Processes in Condensed Matter . ... Nonlinear spectroscopy of condenced matter - semiconductors, HTSC, metals, quantum-size structures, etc. ... 2000-2002: R.V.Khokhlov and S.A.Akhmanov scientific school on nonlinear optics, RFBR, 00-15-96726 . ...

Еще в разделе: (Показать все результаты (>770) - ofvp.phys.msu.ru/ )

• Laboratory of ultrafast processes in biology
• Сайт кафедры общей физики и волновых процессов

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>28) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... Scientific laboratories . ... lheat@cs.msu.su . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 625 (Head of the laboratory), 657, 658, 687 . ... Petrova Ludmila, Senior Research Fellow, PhD . ... Numerical modeling of jet and shock-wave processes on the basis of the Euler equations. ... 3, June 2012. ( http://dx.doi.org/10.5539/jmr.v4n3p00 , ISSN 1916-9795 E-ISSN 1916-9809). ... 2012 . ... CMC MSU students at GSIS Summer School, Tohoku University, Japan...

Еще в разделе: (Показать все результаты (>268) - en.cs.msu.ru/ )

• Laboratory of Heat and Mass Transfer Processes Simulation
• Department of Supercomputers and Quantum Informatics | CMC MSU
• Department of Supercomputers and Quantum Informatics

... Academic . ... Academic Departments . ... Partners . Conferences . ... All partners . ... The international academic conference . ETHNIC PRESS GENESIS, STRUCTURE, DEVELOPMENT TRENDS . ... Conference proceedings will be published at the endљ . of the Conference as a collection of scientific articles and available in electronicљ . ... Organizing Committee address: Department of Journalism, Room 325 A, 3d floor, Main Academic Building, 42 Kulakovskogo St., Yakutsk, 677000. ...

Еще в разделе: (Показать все результаты (>172) - www.journ.msu.ru/ )

The essence of VES data processing may be shown on a flexure fold model (The central part of model is shown on fig.6). 2D modeling data for the flexure fold added with NSI were processed with the IPI-2D package, but at first example deep objects resistivities were made equal to surrounding to neglect their influence. ... Full model of flexure fold with NSI and deep objects . ... Comparison of apparent resistivity fields after filtering (a) and calculated without NSI (b) . ...

Еще в разделе: (Показать все результаты (>84) - geophys.geol.msu.ru/ )

• TES tecnology. MSU.
• TES. Field example.
• Software for resistivity and induced polarization

... Master Education . ... Master programs . ... graduates for activities requiring in-depth fundamental and professional knowledge, including research in applied mathematics and computer technology, development and use of mathematical models for processes and objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematical and Computational Methods of Image Processing ... master thesis...

Еще в разделе: (Показать все результаты (>131) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master program "Mathematical Models of Complex Systems" | Магистерское и
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

... Wiki . ... wiki: WikiProcessors . ... Processors can be thought of as macro functions to process user-edited text . ... Besides their content, some Wiki processors can also accept parameters , which are then given as key=value pairs after the processor name, on the same line. ... Example 3 : Searching tickets from a wiki page, by keywords. {{{ #!html <form action="/query" method="get"><div> <input type="text" name="keywords" value="~" size="30"/> <input type="submit" value="Search by Keywords"/> <!-...

Еще в разделе: (Показать все результаты (>4493) - kodomo.cmm.msu.ru/ )

• Help: templating
• TracEnvironment тАУ Tanchiki

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Faculties . Institutes . Centres . ... Study and Research . ... Lomonosov Moscow State University offers a world class education to everyone with the ability to benefit. ... Department for Academic Policy and Degree Programs Management . Department for Research Policy and Research Management . ... Department of Development Program at Moscow University . ...

Еще в разделе: (Показать все результаты (>202) - www.msu.ru/ )

• FACULTY OF PUBLIC ADMINISTRATION (SCHOOL OF PUBLIC ADMINISTRATION)
• Further Education Programs at MSU
• THE FACULTY OF POLITICAL SCIENCE

The package of application programs for the robust multigrid technique: building blocks and diagnostic tools" . ... A short description of the application package for the robust multigrid technique is given. The technique unites the processes of construction of multigrid structures, computation of index mappings, evaluation of integrals, usage of multigrid cycles, etc. ...

Еще в разделе: (Показать все результаты (>497) - num-meth.srcc.msu.ru/ )

• "Heuristic algorithms of mapping MPI-programs onto multicluster computer and
• A system for analysis of information structure of programs.
• "A program environment for mesh generation, refinement, and partition and for

Standalone Intel/AMD-based SMP/multicore system running under Windows NT 4.0/Windows 2000/Windows XP/Windows Server 2003/Windows Vista/Windows Server 2008/Windows 7. ... use of several physical disks to run each PC GAMESS/Firefly process so that each copy uses only its own HDD. ... Documentation on the command line options . Documentation on the PC GAMESS/Firefly to MPI bindings . ... Finally, you should replace the default mpibind.dll by the MPI binding dll for NT-MPICH-SMP . ... Default is 100. ...

Еще в разделе: (Показать все результаты (>110) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - 64-bit processing support
• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI

... Proposed directory for placement: /pub/os2/dev/mm Your name: Gianfilippo Cimmino Email address: gianfli dot cim @ gmail dot com Program contact name: (same) Program contact email: (same) Program URL: Would you like the contact email address included in listings? yes Operating System/Version: OS/2 Warp ver 4.5 and above Additional requirements: GCC runtime (0.6.4), GCC Core (4.4.6), Libjpeg (8c-1) Replaces: ...

Еще в разделе: (Показать все результаты (>6827) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/hobbes/text-archives/libraw-os2-r0_15_2.txt
• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/hobbes/text-archives/libraw-os2-r0_15_4.txt
• Not so well documented Device Helpers in OS/2

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>264) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• GeneBee service
• Biochemistry (Moscow), Vol

... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...

Еще в разделе: (Показать все результаты (>47) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Postdoctoral training (General Physics and Wave Processes)
• Key research directions

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>108) - www.msm.biophys.msu.ru/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Program topics

log . ... Fri, 01 Apr 2011 17:05:13 +0400 . boris (kodomo) . ... Sat, 26 Mar 2011 10:48:11 +0300 . ... Daniil Alexeyevsky . ... Typo in allpy.fileio.write_strings . ... Fri, 25 Mar 2011 23:12:21 +0300 . ... Automated merge with ssh://kodomo/allpy . Thu, 17 Mar 2011 17:48:37 +0300 . ... Wed, 16 Mar 2011 22:50:50 +0300 . ... Mon, 28 Feb 2011 22:40:16 +0300 . ... allpy.processors: make temporary files named . Tue, 01 Mar 2011 00:17:13 +0300 . boris . ...

Еще в разделе: (Показать все результаты (>30425) - kodomo.fbb.msu.ru/ )

• cca: a308291203ea Help/Help.html
• allpy: 835efa2a8c71 docs/Makefile
• allpy: b520e79fd1f4 docs/Makefile

LangueDOC . ... Texts . ... Apply the program BoxReader to transform the Toolbox document into an XHTML formtat that uses nested tags to represent structure. ... Apply an XSLT stylesheet to transform the XHTML file into the content.xml of the OpenOffice format. ... Add the resulting content.xml into a complete OpenOffice text document replacing the old content.xml . ... Apply the converse XSLT transform to obtain the document in the XHTML nested-span format that can be displayed in the browser . ...

Еще в разделе: (Показать все результаты (>420) - www.philol.msu.ru/ )