... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>854) - imaging.cmc.msu.ru/ )

• Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>10) - www.sciencepark.ru/ )

... DSP board program forms all driving signals for DAC-ADC electronics and stepper motor controller. ... Driving signals formation is defined by scanning regime and by feedback parameters. ... Afterwards values of measured signal and feedback signal go to a computer for further analysis. The fact that feedback loop is closed on signal processor and computer doesn't participate in feedback signal evaluation allow to make feedback more stable and independent from computer work. ...

Еще в разделе: (Показать все результаты (>226) - www.spm.genebee.msu.ru/ )

• Software structure
• Operating system driver
• Scanning Probe Microscopy Image Processing Software User's Manual FemtoScan

... Class . ... Provides an abstraction for multidimensional array access, some concrete implementations, and ways to view a MultiArray as if it had a different structure. ... This interface defines the services required by MultiArrayProxy to manipulate indexes and the dimensions of a MultiArray. ... In the following, we use the unadorned term "array" to mean the Java language construct, and the term "multidimensional array" for the mathematical abstraction modeled by the MultiArray class in this...

Еще в разделе: (Показать все результаты (>58) - angel.cs.msu.su/ )

• Index

To suspend a foreground process: find / -name *.c -print find: cannot read /dev/diag .. Z [1]+ Stopped find / -name *.c -print ps 22926 p9 S 0:03 -Tcsh (Tcsh) 29857 p9 T 0:00 find / -name *.xdh -print 29859 p9 R 0:00 ps mail tony < memo.txt . ... Realising that this process will take a long time to run they stop it while they do something else. They check to see that the process still exists: it does. ... Now they can restart the process again in the foreground or run it as a background job . ...

Еще в разделе: (Показать все результаты (>635) - comet.sai.msu.ru/ )

• Example of cancelling a foreground process
• Examples of using the ps command
• Hypertext Markup Language - 2.0 - Table of Contents

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>256) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• Biochemistry (Moscow), Vol

... This plugin attempts to reduce the instance of Wiki Spam by using the MoinMoin AntiSpamGlobalSolution regex's. Anytime it detects that a saved page contains a string in the regex list, it only refuses to save it. ... Foswiki:Extensions/BlackListPlugin does alot of processing on every topic operation, including view) . ... Refresh the list using the rest script from a scheduled cron job cd [foswiki-bin-directory] ./rest /AntiWikiSpamPlugin/forceUpdate . ... This topic: System > AntiWikiSpamPlugin . ...

Еще в разделе: (Показать все результаты (>7721) - wiki.cmc.msu.ru/ )

• (r1) AntiWikiSpamPlugin < System < Foswiki
• SiteToolStatistics < System < Foswiki
• FastCGIEngineContrib < System < Foswiki

... This plugin attempts to reduce the instance of Wiki Spam by using the MoinMoin AntiSpamGlobalSolution regex's. Anytime it detects that a saved page contains a string in the regex list, it only refuses to save it. ... Foswiki:Extensions/BlackListPlugin does alot of processing on every topic operation, including view) . ... Refresh the list using the rest script from a scheduled cron job cd [foswiki-bin-directory] ./rest /AntiWikiSpamPlugin/forceUpdate . ... This topic: System > AntiWikiSpamPlugin . ...

Еще в разделе: (Показать все результаты (>2345) - wiki.cs.msu.ru/ )

• (r1) AntiWikiSpamPlugin < System < Foswiki
• SiteToolStatistics < System < Foswiki
• (r2) AntiWikiSpamPlugin < System < Foswiki

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Science and education . ... Scientific Laboratories . ... Science . ... Main Science and education Scientific Laboratories Laboratory of Nonlinear Spectroscopy of Ultrafast Processes in Condensed Matter . ... Nonlinear spectroscopy of condenced matter - semiconductors, HTSC, metals, quantum-size structures, etc. ... 2000-2002: R.V.Khokhlov and S.A.Akhmanov scientific school on nonlinear optics, RFBR, 00-15-96726 . ...

Еще в разделе: (Показать все результаты (>770) - ofvp.phys.msu.ru/ )

• Laboratory of ultrafast processes in biology
• Сайт кафедры общей физики и волновых процессов
• Laboratory of solid-state lasers and coherent spectroscopy

The essence of VES data processing may be shown on a flexure fold model (The central part of model is shown on fig.6). 2D modeling data for the flexure fold added with NSI were processed with the IPI-2D package, but at first example deep objects resistivities were made equal to surrounding to neglect their influence. ... Full model of flexure fold with NSI and deep objects . ... Comparison of apparent resistivity fields after filtering (a) and calculated without NSI (b) . ...

Еще в разделе: (Показать все результаты (>75) - geophys.geol.msu.ru/ )

• TES tecnology. MSU.
• TES. Field example.
• TES. Median algorithm

... Academic . ... Academic Departments . ... Partners . Conferences . ... All partners . ... The international academic conference . ETHNIC PRESS GENESIS, STRUCTURE, DEVELOPMENT TRENDS . ... Conference proceedings will be published at the endљ . of the Conference as a collection of scientific articles and available in electronicљ . ... Organizing Committee address: Department of Journalism, Room 325 A, 3d floor, Main Academic Building, 42 Kulakovskogo St., Yakutsk, 677000. ...

Еще в разделе: (Показать все результаты (>172) - www.journ.msu.ru/ )

log . ... Tue, 22 Feb 2011 18:41:31 +0300 . boris (netbook) . ... Daniil Alexeyevsky . blocks3d-wt: reorganized apache configs for more stable operation . ... blocks3d(): fix a bug . ... blocks3d(): return continuous blocks . Mon, 21 Feb 2011 17:53:04 +0300 . ... allpy/structure: add blocks3d method to BlockMixin . ... Sun, 20 Feb 2011 22:19:16 +0300 . ... boris . ... Fri, 18 Feb 2011 19:04:43 +0300 . ... Thu, 17 Feb 2011 18:35:59 +0300 . ... Wed, 16 Feb 2011 23:11:02 +0300 . ...

Еще в разделе: (Показать все результаты (>41987) - kodomo.fbb.msu.ru/ )

• allpy: 7ef0081ffd9c docs/Makefile
• allpy: 0d1ba84a4080 test/usecase2.py

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>264) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR

Irina IVANOVA Transformation of the Southeast Asian social and economic space in the process of integration of the region into the global information economy Introduction. ... Common problems are superconcentration of economic activity in overpopulated centers, poor transport access to peripheries and lack of national and global connectivity. ... The nodes of the spatial framework of the Malacca Strait economic region have hierarchical structure as global, regional, national centers (pic.6). ...

Еще в разделе: (Показать все результаты (>479) - www.geogr.msu.ru/ )

... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... In the first semester students learn VHDL programming language for logic description of their future devices and work on elementary projects on controller kits. ... Implementation of the task ?LED flickering under given frequency?. ...

Еще в разделе: (Показать все результаты (>94) - engineering.phys.msu.ru/ )

• Parallel Programming
• Introduction to Linux
• Lost your Password?

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>33) - dynamo.geol.msu.ru/ )

• Publications of V.Zakharov

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>85) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... 1988) MERCURY Dollfus & Auriere(1974) Veverka et al. ... Lunar Crater name Ptolemaeus Bullialdus Gassendi crater maturity Im Is/FeO 1.452 68 1.451 68 1.415 75 Mercurian wavelength dependence of Pmax and lunar data 1,6 1 1,4 3 1,2 1 5 0,8 0,6 0,4 0,2 0 2,2 2,4 2,6 2,8 3 3,2 log l, (nm) Fig. 3 log Pmax, (%) 2 4 6 Conclusions: Maturity of the soil on the Mercurian surface in scale of whole disk is similar to space weathering of the soil in large old craters on the lunar highland. ...

Еще в разделе: (Показать все результаты (>98) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms082.pdf

TWiki . Our RNA 3D structure prediction web service . ... WebNotify . This is a subscription service to be automatically notified by e-mail when topics change in this Services web. ... Users subscribe to email notifications using their WikiName or an alternative email address, and can specify the webs/topics they wish to track, Whole groups of users can also be subscribed for notification. ... Changes in all these children will be detected and reported along with changes to the topic itself. ...

Еще в разделе: (Показать все результаты (>42009) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (7 vs. 8) - TWiki
• %TOPICTITLE% (6 vs. 7) - TWiki

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>27) - comphep.sinp.msu.ru/ )

• overview [CompHEP]