... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>10) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt

БАКАЛАВРИАТ . ... MBA . EXECUTIVE MBA . ... David с удовольствием посетил многочисленные достопримечательные места г. Москвы: Красную площадь, Большой Кремлевский дворец, Оружейную палату, Большой театр: Профессор университета Carnegie Mellon David L.Lamont провел в ВШБ презентацию Global Management Game и познакомил будущих игроков с правилами и условиями участия в игре в 2003 году! ... Executive MBA . ... Бакалавриат . ... Аккредитация программы Бакалавр . ...

Еще в разделе: (Показать все результаты (>22) - www.mgubs.ru/ )

• Преподаватели западных бизнес-школ на программе МВА-Логистика

... Previous message: [RU-NGI] glite-APEL installation . Next message: [RU-NGI] Fwd: [Inspire-sa1] last glite 3.1 components in staged rollout . Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] . ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>43) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: [Inspire-sa1] upcoming UMD2 SW provisioning
• [Comphep-common] [Fwd: Re: problems with compHEP (Cross- Section)]
• The Home of Home Pages Page

. Библиотека электронных публикаций . Space-Time Code // International Atomic Agency, International Centre for Theoretical Physics, Italy: 25 March 1968. ( DjVu -file, 7 Mb) [distributed 17.06.2011] . Unified Quantum Theory // Conference on Quantum Theory and Structure of Time and Space, July 1974. ( DjVu -file, 9.7 Mb) [distributed 17.06.2011] .

Еще в разделе: (Показать все результаты (>101) - chronos.msu.ru/ )

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... ФАЗИС, 2001. 464 pages (hardcover) . ... Approximate price in Conference bookstall 1680 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>10) - www.mce.biophys.msu.ru/ )

... By Adele Goldberg and David Robson, copyright 1983, Addison-Wesley, ISBN 0-201-11371-6 . ... Compiled Methods . The Bytecodes . The Interpreter . ... Primitive Methods . The Object Memory . ... 27: Specification of the Virtual Machine . Form of the Specification . ... Objects Used by the Interpreter . ... 28: Formal Specification of the Interpreter . ... 29: Formal Specification of the Primitive Methods . ... An Allocation Algorithm . ... A Simple Reference-counting Collector . ...

Еще в разделе: (Показать все результаты (>12) - sp.cs.msu.ru/ )

June 29, 2015 . ... 10.00-11.25 Chair: N. Nikitin . ... Physics Prospects at Belle-II . ... Alexey Dzyuba (Petersburg NPI, Russia) . ... Davide Meloni (University of Roma Tre, Italy) . Recent developments in Neutrino Physics . ... 17.30 - 19.10 Parallel section A: Collider and neutrino physics Chair: L. Gladilin . ... Pair correlations in particle and jet production at the LHC in the parton Reggeization approach . ... V. Kuksa (Research Institute of Physics, Southern Federal University, Russia) . ...

Еще в разделе: (Показать все результаты (>13) - qfthep.sinp.msu.ru/ )

... redirect an entire server or directory to a single URL . ... stop/restrict robots . proxy SSL requests through your non-SSL server . There are two chief ways to redirect all requests for an entire server to a single location: one which requires the use of mod_rewrite , and another which uses a CGI script. First: if all you need to do is migrate a server from one name to another, simply use the Redirect directive, as supplied by mod_alias : Redirect / http://www.apache.org/ . ...

Еще в разделе: (Показать все результаты (>2) - neptun.sai.msu.ru/ )

... Австралия --- (оригинал: от David Mar ) . Австрия --- (оригинал: от Edward F. Redish и www.clark.net ) . ... Англия , --- (оригинал: от Edward F. Redish ) . ... Германия --- (часть оригиналов из Edward F. Redish , www.clark.net и World Banknote Collector's Club ) . ... Зимбабве --- (оригиналы от GeoCities WallStreet 8075 ) . ... Израиль --- (оригинал: от Edward F. Redish и из ftp.hea.ie ) . ... Италия --- (оригинал: от Edward F. Redish ) . ... Канада --- (оригинал: Canadian Paper Money Q&A ) . ...

Еще в разделе: (Показать все результаты (>119) - xray.sai.msu.ru/ )

• Image: cimg2346
• Image: cimg2135
• Image: cimg2136

... Авторский указатель . Систематический указатель . Морфология клеток и колоний диссоциантов бактерий . ... Клеточные оболочки диссоциантов бактерий . ... Unique Phenotype of Opaque Cells in the White-Opaque Transition of Candida albicans , DJVU-файл, 218 Кб . ... 1) Proportion of cells exhibiting different patterns of F-action granule localization , DJVU-файл, 5 Кб . 2) Proportion of cells stained with anti-opaque-cell serum preabsorbed with hyphae or opaque budding cells , DJVU-файл, 7 Кб ...

Еще в разделе: (Показать все результаты (>6) - dis.bio.msu.ru/ )

... Бизнес-инкубаторе Московского университета имени М.В. Ломоносова прошел meet up с калифорнийским бизнес-ангелом . 24 сентября в Бизнес-инкубаторе МГУ имени М.В. Ломоносова прошел meet up с калифорнийским бизнес-ангелом David Maracini. ... Вторым гостем meet upа стала Татьяна Поспелова, выпускница и аспирантка МГУ имени М.В. Ломоносова, менеджер компании Penxy, которая рассказала, как живут российские проекты в Силиконовой Долине. ... Бизнес-инкубатор МГУ . ... 2003 2011 MsuNews.Ru Новости МГУ . ...

Еще в разделе: (Показать все результаты (>11) - www.msunews.ru/ )

... Copyright ? 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>42) - itpm.msu.su/ )

• Links
• The Linux Kernel: Table of Contents
• Linux Installation and Getting Started

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>155) - www.pereplet.ru/ )

Поиск внеземного разума привлекает внимание многих ученых и крайне интересует молодых студентов Это делает данную тему идеальной для постановки научного образования. Главные усилия сейчас должны быть направлены на создание нового научного обучения на базе SETI . ... Доклад, представленный на Техническую сессию Комиссии 51 MAC, Буэнос-Айрес, август 1991. Доклад, представленный на Симпозиуме SET1 МАА- Монреаль, октябрь 1991 ...

Еще в разделе: (Показать все результаты (>63) - lnfm1.sai.msu.ru/ )

• jg0007

... redirect an entire server or directory to a single URL . ... stop/restrict robots . proxy SSL requests through your non-SSL server . There are two chief ways to redirect all requests for an entire server to a single location: one which requires the use of mod_rewrite , and another which uses a CGI script. First: if all you need to do is migrate a server from one name to another, simply use the Redirect directive, as supplied by mod_alias : Redirect / http://www.apache.org/ . ...

Еще в разделе: (Показать все результаты (>111) - rtm-cs.sinp.msu.ru/ )

• Bzip2 mini-HOWTO

... The Behavior of Jewish Communities and their Losses Dr Wioletta Pawlikowska-Butterwick ( Lithuanian Catholic Academy of Sciences) Property Relations in the Jurydyka of the Vilnius Cathedral Chapter in the Sixteenth Century Discussion 5.45 pm 6.30 pm CLOSE Reception at the Polish Embassy, 47 Portland Place, London W1B 1JH Saturday 21 March: SSEES [room tbc] 9.00 am Second panel : Patrons and clients Dr Artras Vasiliauskas Vilnius ...

Еще в разделе: (Показать все результаты (>130) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal
• Книги по истории Церкви и христианской археологии

Лекция "GPUs Revolutionized Graphics and Impacted Parallel Computing; Now, Let's go after Science!" ... Сейчас GPU - это универсальные программируемые массивно-параллельные вычислители. ... David B. Kirk - NVIDIA Fellow, former NVIDIA's chief scientist http://www.nvidia.com/object/bio_kirk.html David Kirk is an NVIDIA Fellow and served as NVIDIA's chief scientist from 1997 to 2009, a role in which he led the development of graphics technology for today's most popular consumer entertainment platforms. ...

Еще в разделе: (Показать все результаты (>18) - polly.phys.msu.ru/ )

docs.kde.org . Благодарности и лицензия . ... Авторские права на KWord 1999-2005 принадлежат разработчикам KWord . Разработчики KWord (в алфавитном порядке) . ... Фрэнк Декервель (Frank Dekervel) (frank.dekervel AT student.kuleuven.ac.be) . ... Дэвид Фаур (David Faure) (faure AT kde.org) . Николас Готт (Nicolas Goutte) (goutte AT kde.org) . ... Разработчики фильтров импорта/экспорта KWord (в алфавитном порядке) . ... Кларенс Данг (Clarence Dang) (dang AT kde.org) . ...

Еще в разделе: (Показать все результаты (>35) - uneex.lorien.cs.msu.su/ )

• Глава 9. Благодарности и лицензия
• Глава 13. Авторские права и лицензирование

arxiv:0902.3247 Регистрация HR 8799b в 1998 г. с помощью HST/NICMOS (HST/NICMOS detection of HR 8799 b in 1998) . ... arxiv:0902.2794 SN 2008ha: сверхновая с экстремально низкой светимостью и энергетикой (SN 2008ha: an extremely low luminosity and extremely low energy supernova) . ... Authors: A.A. Abdo et al. arxiv:0902.0996 Определение расстояния до двойного пульсара J0737-3039A/B по данным VLBI (Implications of a VLBI Distance to the Double Pulsar J0737-3039A/B) . ... Authors: Rachel Howe ...

Еще в разделе: (Показать все результаты (>233) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0406.html
• http://xray.sai.msu.ru/~polar/sci_rev/1506.html
• http://xray.sai.msu.ru/~polar/sci_rev/1406.html