STARTINCLUDE% #VarENDCOLOR ---+++ ENDCOLOR -- end colored text * =ENDCOLOR= is one of the shortcut macros predefined in DefaultPreferences. See the section [[ DefaultPreferences #RenderingShortcuts][shortcut macros ]] in that topic for a complete list of shortcuts. br/ *Example:* pre class= tml % nop GREEN% green text % nop ENDCOLOR % /pre *Expands to:* %GREEN% green text % ENDCOLOR % %INCLUDE{ % ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>4928) - wiki.cmc.msu.ru/ )

• ReferenceManual < System < Foswiki

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>2824) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Over virtually the complete
• Экологический Форум - Фундаментальная Экология: Over nearly the complete
• Laboratories: Laboratory for Ecology of Arid Territories: Publications

The sections <Directory> , <Location> and <Files> can contain directives which only apply to specified directories, URLs or files respectively. Also htaccess files can be used inside a directory to apply directives to that directory. ... The order of merging is: . ... If multiple <Directory> sections apply to the same directory they are processed in the configuration file order. ... Using the options in question is only possible inside a <Directory> section (or a .htaccess file). ...

Еще в разделе: (Показать все результаты (>74) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache directives

... Sections . ... Division of Exhibition . ... Results of 2012 . Results of 2013 . ... Invertebrate Zoology . Section staff . History of the Section . ... Collections . Invertebrate collections . ... Schemes of the museum halls . ... Exhibition of Invertebrates . ... Exhibition of Insects Exhibition of Invertebrates Exhibition of Fish Exhibition of Amphibians Exhibition of Reptiles Exhibition of Oceanic Hydrothermal The Scientific Terrarium The Circle of Young Naturalists . ...

Еще в разделе: (Показать все результаты (>937) - zmmu.msu.ru/ )

• Invertebrate Zoology
• Ichthyology
• Fish collections

UI delegate for view function . ... view StaticMethod view ($session) . viewfile StaticMethod viewfile ($session,$web,$topic,$query) . view command handler. This method is designed to be invoked via the UI::run method. Generate a complete HTML page that represents the viewed topics. The view is controlled by CGI parameters as follows: . ... topic revision to view . ... restrict view to a named section . ... viewfile command handler. ... Command handler for viewfile. ...

Еще в разделе: (Показать все результаты (>34216) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (22 vs. 23) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• %TOPICTITLE% (29 vs. 30) - TWiki

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>1988) - crydee.sai.msu.ru/ )

• Crydee.sai.msu.(ru,su) Archive
• Keyword arguments and default arguments
• Troubleshooting

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>157) - www.pereplet.ru/ )

A stream of data provided to a QNPInstance by the browser. This class is part of the Qt NSPlugin Extension. ... QNPStream ?()? . const?char*? url ?()?const . ... bool? seekable ?()?const . bool? okay ?()?const . ... void? requestRead ?(?int?offset, uint?length?)? . ... QNPStream ?(?QNPInstance?*, const?char?*, _NPStream?*, bool?)? . ... Creates a stream. ... Returns TRUE if the stream has received all the data from the source. ... Returns the QNPInstance for which this stream was created. ...

Еще в разделе: (Показать все результаты (>583) - rtm-cs.sinp.msu.ru/ )

• How Directory, Location and Files sections work
• Migrating Objects
• Qt Toolkit - QNPStream member list

This document describes how to perform update from the PC GAMESS version 7.1 build # 4471 to the PC GAMESS version 7.1.5 build # 4630 . Verify that your PC GAMESS installation is version 7.1 build # 4471. ... Note that this patch works only with the official PC GAMESS v. 7.1 build # 4471 binaries. ... After successful completion of the patch process, the PC GAMESS version 7.1.5 build # 4630 binary executable file will be written to the file pcgamess.715.exe (Windows)/ pcgamess.715 (Linux). ...

Еще в разделе: (Показать все результаты (>44) - classic.chem.msu.su/ )

• Firefly Home Page
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• Firefly DOCUMENTATION - command line arguments

. Next: UUCP Configuration Files Up: Introduction Previous: The Inner Workings of . This section describes the most important command line options for uucico. For a complete list, please refer to the uucico(1) manual page. Andrew Anderson . Thu Mar 7 23:22:06 EST 1996

Еще в разделе: (Показать все результаты (>297) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• perchild - Apache HTTP Server
• The Linux Kernel (Copyright Notice)

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>158) - hist.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>16) - angel.cs.msu.su/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>25) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE provides the major photonuclear databases. Online Services.

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>667) - theory.sinp.msu.ru/ )

• Polar vectors
• [RU-NGI] Fwd: CERN CA Website IP change
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>105) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!
• editor | С Днем Победы!

08.02.15 A personal page of professor Alexander P. Ryjov is updated . ... 19.11.05 9th International Conference "Intelligent Systems And Computer Sciences", october 2006. ... 12.03.05 "Magazine" section is added . ... Academician) is added . ... 12.03.05 A personal page of Alexander B. Kholodenko (Junior researcher) is added . 12.03.05 A personal page of Pavel A. Panteleev (Junior researcher) is added . ... 12.03.05 A personal page of Alexander N. Safiullin (Junior researcher) is added . ...

Еще в разделе: (Показать все результаты (>74) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Zhuk Dmitriy
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles

Backlinks to TemplateTopics in System Web ( Search all webs ) . ... Related topics: CommentPluginTemplates, .CommentPluginExamples .. NEW - 10 Apr 2011 - 18:03 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... TemplateTopics has more) . ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... NEW - 05 Nov 2010 - 13:09 by ProjectContributor . ...

Еще в разделе: (Показать все результаты (>1875) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) TemplateTopics < System < Foswiki
• HistoryPlugin < System < Foswiki
• (backlinks in all Webs) ChangeEmailAddress < System < Foswiki

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>83) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>139) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf