... List Of Participants . ... 8:00-10:30 Educational Lectures for the students UlSU and UISS young participants . ... 17:30 Cultural program (excursions along Ulyanovsk historical part, etc) . For September 16-17 culture program is planed. It includes walk to the wonderful place-forest on Volga bank, trip along Volga, etc. ...

Еще в разделе: (Показать все результаты (>341) - xray.sai.msu.ru/ )

• No Title
• State of the problem

All these programs are written on FORTRAN 77. ... Listing of the main routine, the function and the results ( fig4_2.txt ). Listing of the subroutines ( listing_01.txt , listing_01.zip ). ... The block (the main routine, the function and the subroutines (+general)). ( application_01.zip ). ... General programs. ... All listings of the subroutines ( all_listings.zip , all_listings.txt ) and the main routines with the functions and the results ( all_figures.zip , all_figures.txt ). ...

Еще в разделе: (Показать все результаты (>32) - foroff.phys.msu.ru/ )

• Admission Regulation
• The Faculty System of Education

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>79) - www.msm.biophys.msu.ru/ )

... The Finite and the Infinite: A New view on the problem . ... The indisputable fact that all the material phenomena making up he Universe without exception are finite, confirms this statement. ... It should be stressed in this connection that there are convincing theoretical and experimental data proving the number of the potential changes and transformations of the material phenomena making up the Universe is finite. ...

Еще в разделе: (Показать все результаты (>452) - chronos.msu.ru/ )

• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and

... Give an example of chemical reaction between a salt and an acid leading to the formation of another salt and a base. (1 point) [Solution] . ... Write the reactions of chromium (III) bromide with hydrogen peroxide in acidic and basic media. (2 points) [Solution] . ... In the reactions, specify the structures of all substances. (3 points) [Solution] . ... Three substances A, B, and C were mixed in the amount of three moles each. ... Example problems in chemistry for the entrance exams ( main round ) ....

Еще в разделе: (Показать все результаты (>343) - chem.msu.ru/ )

• Systematical Search for New Types of Chemical Interconversions: Mathematical
• Entrance Examinations - Main Round
• Hot News. Russian XV International conference on chemical thermodynamics

Maximum RPM: Taking the Red Hat Package Manager to the Limit . ... While it's certainly no problem to add a prefix tag line to a spec file, it's necessary to consider a few other issues: . ... Other software must not rely on the relocatable package being installed in any particular location. ... The fact that every file in a relocatable package must be installed under the directory specified in the prefix line, raises some issues. ... Set the prefix to /etc and package everything under /etc . ...

Еще в разделе: (Показать все результаты (>1503) - uneex.lorien.cs.msu.su/ )

• A Few Handy Queries
• Real-World Package Building
• HelpOnInstalling/ApacheOnWin32withDomainAuthentication - UNИX

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>144) - en.cs.msu.ru/ )

• Laboratory of Mathematical Problems of Computer Security | CMC MSU
• Department of Functional Analysis and its Applications
• Laboratory of Mathematical Problems of Computer Security

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Align tool for DNA-protein complexes

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

30. Tatjana Khruzina

31. Экологический Форум - Фундаментальная Экология: i just completed a whole

32. 39th INTERNATIONAL CHEMISTRY OLYMPIAD

33. Problems?

34. InCo literature in English

35. Abstract

36. [RU-NGI] File transfer problem

37. INSTITUTE OF ASIAN AND AFRICAN STUDIES

38. Unsolved problems and new prospects

39. Nonlinear Problems of Gydrodynamic Stability Theory

40. Moscow State University. Faculty of History. About us.