The conference "Human Rights in Russia: the past and the present" was held in Perm city on the 21 st - 23 rd of June. Different scientists, human rights activists, teachers of human rights, including the participants of the Russian - American exchanges took part in the conference. ... The representative of the president of Russia G. A. Zaitzev, vice - governor V.G. Sergeev, vice - mayor of Perm city O.M. Zdanov opened the conference with the greeting. ...

Еще в разделе: (Показать все результаты (>110) - www.prof.msu.ru/ )

Maximum Parsimony Interpretation of Chromatin Capture Experiments Dirar Homouz, Gang Chen, Andrzej Kudlicki Department of Biochemistry and Molecular Biology Institute for Translational Sciences University of Texas Medical Branch, Galveston, TX, USA The three-dimensional conformation of the genome plays an important role in gene regulation at a wide range of scales, including the distribution of the nucleosomes, the folding of chromatin , as well as chromosomal ...

Еще в разделе: (Показать все результаты (>259) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/28.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/47.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/49.pdf

... 9 container is iterable collection of items. 10 item is object getting markup data (new attribute). 11 . ... 32 def __init__ ( self , name , container , map_out = {}): . ... 40 def set_map_out ( self , map_out ): . ... 44 def set_map_in ( self , map_in ): . ... 54 def __getitem__ ( self , item ): . ... 65 def __contains__ ( self , item ): . ... 88 def from_string ( cls , string , name , container , map_out = {}): . ... 94 self = cls ( name , container , map_out ) . ... 103 def items ( self ): . ...

Еще в разделе: (Показать все результаты (>14298) - kodomo.fbb.msu.ru/ )

• allpy: ee2c10aa74b8 allpy/util.py
• allpy: b5a910f0980f allpy/markup.py
• allpy: e115d12d354b allpy/markup.py

This document explains some of the directives provided by the core server which are used to configure the basic operations of the server. ... Process Creation . Network Configuration . ... User . ... A single control process is responsible for launching child processes which listen for connections and serve them when they arrive. ... The User and Group directives are used to set the privileges of the Apache child processes. ... The child process creates multiple threads to serve requests. ...

Еще в разделе: (Показать все результаты (>107) - neptun.sai.msu.ru/ )

• Apache Server Virtual Host Support
• Apache IP-based Virtual Host Support
• Apache module mod_setenvif

... All circuit parameters have been presented in a symbolic form. ... To use the program you will need a CIR file (PSpise, DesignLab file) of your circuit. CIR file examples have been enclosured: bpasside.cir, test1.cir, test2.cir, test3.cir, test4.cir, laksamp.cir, bridge.cir, uA741acf.cir, quartz.cir. ... Ideal operational amplifier (nullor) * Nname n1 n2 n3 n4 * * In the ideal op amp data, (n1,n2) represent output nodes, * (n3,n4) represent input nodes (noninverting, inverting). ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

• Symbolic matrix processor

... Anisotropy effects investigations by resistivity method. ... I.N.Modin. ... Pervago E.V., Bobachev A.A., Modin I.N., Shevnin V.A. Report, presented at Annual SAGEEP conference, April 1995, Orlando, Florida, USA. 1 p. RESISTIVITY PROSPECTING IN URBAN REGIONS . ... Bobachev A.A., Modin I.N., Pervago E.V.Proceedings of 5th EEGS-ES Meeting in Budapest, Hungary, September 1999. ... Bobachev A.A. Modin I.N., Pervago E.V., Shevnin V.A.Proceedings of 5th EEGS-ES Meeting in Budapest, Hungary, September 1999....

Еще в разделе: (Показать все результаты (>72) - geophys.geol.msu.ru/ )

• TRF_2d. Page2

Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... UFFO . ... April 12, 2011 . The weight-dimension and thermal models of scientific equipment blocks of the spacecraft are delivered to R&D Institute of Electromechanics ? ... Discussed issues related to the flight model ofљ UFFO device. The scientific equipment systems were joined with UFFO block. ... Debugging and joining of scientific equipment with UFFO block were made. ...

Еще в разделе: (Показать все результаты (>22) - lomonosov.sinp.msu.ru/ )

Na, Ca, Mg, Cl, SO4, HCO3. The article presents experimental tools to determine rejection values of nanofiltration membranes OPMN-K for different ionic species depending on ionic composition of feed water. ... Fe2+ F-. ... 2004, 3 (23) ()1. ... F- Fe2+ Na+, Ca2+, Mg2+, SO42-, HCO3-, Cl-. ... Na+, Cl-, HCO3-) Fe2+ F. (Ca2+, SO42-), Fe2+ F ( , «» ). ... 2 - 4] Na+, Ca2+, Mg2+, SO42-, HCO3-, Cl- . ... 300 , 600 900 . ... Na+, Cl-, SO42-, Ca2+, Mg2+ HCO3- . ... Ca2+, Fe2+, F­ ( ): ) ; ) 600 . ...

Еще в разделе: (Показать все результаты (>632) - chem.msu.ru/ )

• Colloid-chemical phenomena in wastewater containing lignosulphonates
• Moscow University Chemistry Bulletin Vol. 52, No. 2, P. 130 (2011)
• FTIR reflection spectroscopy control of daguerreotype cleaning operations

. PHP Manual . Prev . Next . (PHP 4 >= 4.0.5) yaz_present -- Prepares for retrieval (Z39.50 present). int yaz_present ( (void);) . This function prepares for retrieval of records after a successful search. The yaz_range() should be called prior to this function to specify the range of records to be retrieved. Prev . Home . Next . yaz_search . Up . yaz_syntax

Еще в разделе: (Показать все результаты (>1004) - oit.cmc.msu.ru/ )

• yaz_search
• mb_strcut
• sprintf

... The nodes defined by the specified region and lattice spacing will be set equal to one of three possible values depending on whether the node is outside, on the polygon perimeter, or inside the polygon. ... The xy-files simply represent data point locations and the mask is set to the inside or outside value depending on whether a node is within a maximum distance from the nearest data point. ... Default is grid registration]. ... S Set nodes depending on their distance from the nearest data point. ...

Еще в разделе: (Показать все результаты (>450) - xray.sai.msu.ru/ )

• Art Gallery
• Concluding Remarks and Future Prospects
• Detection rate of binary compact star merging

Fast direct large-scale MCSCF code for Segmented and General Contraction Basis Sets Alexander A. Granovsky Laboratory of Chemical Cybernetics, M.V. Lomonosov Moscow State University, Moscow, Russia September 14, 2005 Large-scale MCSCF Main steps of MCSCF iteration ( unfolded two step type) Integral transformation CI problem DM1 DM2 calculation ... Alternative approach: (pq|) ... Reminiscence: Fock Matrix F2(D) = J(D) - K(D) J = (|) ...

Еще в разделе: (Показать все результаты (>87) - classic.chem.msu.su/ )

• Just CUDing: Firefly v. 7.1.G standard MP4(SDTQ) benchmark on NVidia GPUs or
• PC GAMESS/Firefly DOCUMENTATION - MPI bindings for Windows
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI

Biochemical analysis of the metabolism of small rodents living in different radioecological conditions . ... The initial differences of metabolism and their modification under the conditions of radioactive pollution of the environment are presented on the basis of the complex of biochemical parameters of two ecologically different species of small rodents ( Apodemus uralensis and Myodes rutilus ). ...

Еще в разделе: (Показать все результаты (>1182) - zmmu.msu.ru/ )

• Present distribution of Pipistrellus kuhlii in the Volga region
• Circadian activity rhythms of dwarf hamsters (Phodopus spp.) under laboratory
• Epigenetic variation of the common shrew, Sorex araneus, in different habitats

... Bachelor Program . ... The Department of Operations Research . ... Department of Operations Research was founded in 1970 by an outstanding scientist Yury Borisovich Germeier , who played a large role in development of operations research and game theory. ... Department develops both traditional disciplines, such as game theory, optimization theory and methods , mathematical models in economic analysis, and new fields related to modeling of market economy, banking and insurance activity. ...

Еще в разделе: (Показать все результаты (>27) - io.cmc.msu.ru/ )

... PyMol is a powerful drawing instrument and here we show how to plot Fukui function with PyMOL after two calculation steps with FireFly (PC-GAMESS). ... Because total HOMO orbital have two electrons and should be divided by two (see equations at the beginning). 1 комментарий " Building and plotting Fukui function with FireFly and PyMol " . Quantum chemistry information page ERG Research Group: Лаборатория теоретической биофизики написал (Май 20th, 2015 12:43 пп) . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>58) - erg.biophys.msu.ru/ )

... THE PARALLELIZATION OF COMPUTATIONAL ALGORITHMS IN LARGE PHYSICS PROBLEMS ON MULTIPROCESSOR COMPUTER SYSTEM CONTAINING THOUSAND AND MORE OF PROCESSOR ELEMENTS REQUIRES SPECIAL TOOLS. ... THE GENETIC ALGORITHM CAN BE CHARACTERIZED BY THE FOLLOWING PARAMETERS: - coding strategy, - population size, - initialisation strategy, - selection technique, - crossover mechanism, - mutation mechanism, - strategy for offspring inclusion. ... The results are presented on the following figure. ...

Еще в разделе: (Показать все результаты (>44) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/severyanov/Severyanov-poster.ps
• http://acat02.sinp.msu.ru/presentations/litinski/litinski.doc

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>14) - halgebra.math.msu.su/ )

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>154) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.PRIA.Nasonov_Krylov.Areas.en.pdf
• http://imaging.cs.msu.ru/pub/2010.DSPA.Lyubimov_Lukin.CWM.ru.pdf
• http://imaging.cs.msu.ru/pub/2012.CISP-BMEI.Chernomorets_Krylov.RetinalQ.en.pdf

Some additional inquiry information . ... Schemes of phylogenetic trees . Phylogenetic trees present one of the ways of reconstructing evolutionary interconnections between different proteins. ... That means, that all the information given in the tree should be checked . ... Scheme is a bracket structure. It consists from brackets, commas and names of taxons (taxon is a phylogenetic analog of protein and, hence, amino acid sequence). ... Inside a pair of brackets there is a branch of the tree. ...

Еще в разделе: (Показать все результаты (>46) - monkey.belozersky.msu.ru/ )

• ETS_all_contacts alignment
• About authors ot this complex
• About this project

... Pyrococcus furios (14506) [f] 149 41.9 3.6e-05 AE010241 AE009950 |AE010241| ... Pyrococcus furiosus DSM 3 (14506 nt) initn: 141 init1: 116 opt : 149 Z-score: 163.3 bits : 41.9 E(): 3.6e-05 banded Smith-Waterman score: 149; 78.8% identity (78.8% similar) in 52 nt overlap (19-69:9586-9637) 10 20 30 40 U00096 TGGTGCTGATACCCAGAGTCGAACTGGGGACCTCACCCTTACCAAGGG : :::: ::::::: : ::::::::: : AE0102 TTATTAAAAACATGGAGCCCCGGCCGGGCTTTGAACCCGGGACCTGCCGCTTACCAAGCG 9560 9570 9580 9590 9600 9610 50 60...

Еще в разделе: (Показать все результаты (>1255) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/TracIni?version=1&format=txt
• http://kodomo.cmm.msu.su/FBB/year_03/doc/term3/EMBnet_unix.pdf
• TracWorkflow тАУ Tanchiki

... Sulfated and sulfonated polymers are able to solubilize efficiently the protein aggregates of different nature. ... The present work describes a new approach to solubilizing pre-formed protein aggregates with sulfated or sulfonated polymers (polysulfoanions). For the first time it was shown that polysulfoanions are capable of solubilizing amorphous and amyloid protein inclusion bodies as well as thermal aggregates. ...

Еще в разделе: (Показать все результаты (>94) - biochem.bio.msu.ru/ )

• [application of the analytical transmission electron microscopy techniques for
• Chaperone-like activity of monomeric human 14-3-3zeta on different protein
• Biochemistry Department of Moscow State University | History