Laboratories \ Laboratory for behavior and behavior ecology of mammals \ Publications . ... Publications . ... 2002. Vol. ... Condition of the Leopard Population in the Caucasus // Beitrage zur Jagd Wildforshung. ... Naidenko S.V. Body mass dynamic in Eurasian lynx Lynx lynx kittens during lactation // Acta theriologica. ... Poyarkov A.D., Subbotin A.E. The snow leopard status in Russia // Proceeding of contributed Paper to the snow leopard survival Strategy Summit May 2002. ...

Еще в разделе: (Показать все результаты (>11726) - www.sevin.ru/ )

• Rodens et Spatium :: Brief history of Myshkin
• Экологический Форум - Фундаментальная Экология: number in expensive, totaled
• Laboratories: Laboratory of Avian's Ecology and Behaviour Control: Goals and

... Information for foreign students . ... About 1200 students of all the courses are trained at the Faculty. ... Foreign students enter the Faculty of Geology after 1-year course of Russian language in the Center of International Education of Moscow State University. ... Geology . ... Foreign students of Faculty of Geology during their field geological training in the Crimea Entrance Requirements: Secondary Education Diploma . ... Geological Surveying and Prospecting for Mineral Deposits . ...

Еще в разделе: (Показать все результаты (>163) - www.geol.msu.ru/ )

• Faculty of Geology >> Departments
• Faculty of Geology >> Geology at Moscow State University

fitshdr_expand - expand/extend FITS-file header fitshdr_expand [options] FITSfile_name . fitshdr_expand utility allows to expand/extend existent FITS headers. FITS MultiExtentionsFiles included). fitshdr_expand is just simple shell script around fitshdr utility. --header-no= NNN . Where NNN - FITS-header's number (0,1,.. ... By default 1. --help . Output a brief help message and exit. --version . Print the version number of fitshdr_expand to standard output and exit. --nobackups . ...

Еще в разделе: (Показать все результаты (>592) - lnfm1.sai.msu.ru/ )

• Rules for rough data file

ECPP . ECPP (Elliptic Curve Primality Proving) is a package containing a primality proving program. It is based in particular on the multiprecision package BigNum. Proving the primality of a given integer is a basic task in number theory. You can also use ECPP to build primes for cryptographic reasons. ... http://ultralix.polytechnique.fr/~morain/Prgms/ecpp.english.html . ... Debian Package: No . ... None . ... User Comments: . ... SAL Home | Mathematics | Number Theory . ...

Еще в разделе: (Показать все результаты (>6327) - www.sai.msu.su/ )

• SAI phone numbers
• Torsten Martinsen's GIMP plug-ins
• SAL- Mathematics - Number Theory - NTL

... This class uses Chain of Responsibility (GOF) pattern to dispatch handler calls to registered plugins. ... finish ObjectMethod finish () . ... ObjectMethod preRenderingHandler ($text,\%map) . ... ObjectMethod beforeAttachmentSaveHandler ($attrHashRef,$topic,$web) . ... ObjectMethod renderFormFieldForEditHandler ($name,$type,$size,$value,$attributes,$possibleValues) -> $html . ... Called just after the rename/move/delete action of a web, topic or attachment. $oldWeb - name of old web . ... attachment...

Еще в разделе: (Показать все результаты (>40726) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (57 vs. 61) - TWiki

. SDPpred: a tool for prediction of amino acid residues that determine differences in functional specificity of homologous proteins .

Еще в разделе: (Показать все результаты (>1072) - monkey.belozersky.msu.ru/ )

... Scientific laboratories . ... Head of the laboratory: Gorkov Valery, Senior Research Fellow, PhD Contact information . ... loz@cmc.msu.ru . ... The Laboratory of Inverse Problems was established in 1996 through integration of two laboratories: the lab of Mathematical methods of structural analysis and the lab of Methods for automation of an experiment. ... From the earliest days of its existence, Prof. Boris Shchedrin is the chief and the leader of the Laboratory. ... Second CMC MSU ? ... CMC MSU ? ...

Еще в разделе: (Показать все результаты (>268) - en.cs.msu.ru/ )

• Department of Supercomputers and Quantum Informatics
• Department of Supercomputers and Quantum Informatics | CMC MSU
• Laboratory of Inverse Problems

... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...

Еще в разделе: (Показать все результаты (>146) - bioinf.fbb.msu.ru/ )

• RNA Alignment
• RNA Kinetics: Theory

The Status popup displays useful information about the state of sets, regions, and graphs. ... When the number of sets is less than 30, this button is not needed, use the scroll bars to view the status of the sets that are not shown in the display. ... Operations in the Status popup are performed by clicking on the operation, then clicking on one or more set numbers shown in the display. ... Clicking on Copy followed by clicking on a set number in the scrolled window will select the set to copy from. ...

Еще в разделе: (Показать все результаты (>769) - xray.sai.msu.ru/ )

• Massive X-ray Binaries
• Canadian Paper Money - Questions Answers
• Australian Currency

... DESCRIPTION # # Computes combination between two (or more) .cube files (e.g. the output # of Siesta's grid2cube). ... added. # use strict; #-------------# # Variables # #-------------# my $svn_revision = r97 2007-06-29 18:02:55 ; my @ files ; # list of files to process my %do; # what to do with each file ( file = +1/-1) my $ atoms ; # string with atoms and geometry my %fb; # hash with file = [@bulk] info my @gnp; # (n1,n2,n3) - ...

Еще в разделе: (Показать все результаты (>36) - erg.biophys.msu.ru/ )

• http://erg.biophys.msu.ru/tpp/

English version] [Pyc.- ... The laboratory was founded in 1991, when Cellulase Research Group at the Division of Chemical Enzymology, M.V.Lomonosov Moscow State University, received the status of laboratory. From the moment of establishment of the Division of Chemical Enzymology in 1974 by Professor Ilya Berezin, Cellulase Research Group was led by Dr. Anatole Klyosov. ... Enzymology, biochemistry and biotechnology of enzymes catalyzing the biodegradation of polysaccharides: . ...

Еще в разделе: (Показать все результаты (>209) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Efremenko E.N.

Shows a complete history of a topic. ... When using PatternSkin enabling the HistoryPlugin changes the "History" link in the bottom action bar so it opens a page with a nice user interface where you can select the versions to compare. ... If RevCommentPlugin is installed and activated the "History" page will show the comments entered for each revision. ... Default layout: a simple list of topic revisions using the default format (see below) . ... Version: . ... Foswiki::Plugins::VERSION 1.024 . ...

Еще в разделе: (Показать все результаты (>19705) - wiki.cs.msu.ru/ )

• PerlDoc < System < Foswiki
• (backlinks in all Webs) JQueryLoader < System < Foswiki
• (backlinks in all Webs) JQueryCorner < System < Foswiki

... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...

Еще в разделе: (Показать все результаты (>194) - higeom.math.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>67) - www.socio.msu.ru/ )

... Second, alignment of highly similar genomic sequences is useful for comparison of genome assemblies of the same organism or closely related ones. ... Nucleotide pangenome (NPG) of an input set of genomes is a set of aligned blocks, each block composed of orthologous fragments. ... Hemi-stable blocks (h-blocks) include no more than one fragment of a genome and lack a fragment of at least one of genomes. ... Blocks with repeats (r-blocks) include more than one fragment from one or several genomes. ...

Еще в разделе: (Показать все результаты (>348) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/30.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/18.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/197.pdf

. Since 1994... C 1994 года... "Informregistr" Registration Number 0229702576 . Руководитель проекта академик В.В. Лунин . Письмо редактору .

Еще в разделе: (Показать все результаты (>1835) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 53, No. 6 (2012)
• Moscow University Chemistry Bulletin Vol. 56, No. 4, P. 221 (2015)
• ANALYTICAL CHEMISTRY DIVISION

... Version history . ... Fortran-DVM and C-DVM languages supported data distribution by equal blocks and corresponding distribution of parallel loop iterations (data parallelism). ... A new toolkit - DVM-program performance analyzer was included in the version. ... Fortran-DVM and C-DVM languages support now data distribution by non-equal blocks and parallel executed program section specification (task parallelism). ... The version 3.30 (27.12.2000) is differ from version 3.15 in the following: . ...

Еще в разделе: (Показать все результаты (>192) - sp.cs.msu.ru/ )

• Performance of DVM-programs
• Lib-DVM library. Detailed design. Part 3 (12.1-12.2)
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

. You can check out an earlier version of a file. Use the command: sccs get -r version number .

Еще в разделе: (Показать все результаты (>404) - comet.sai.msu.ru/ )

• Ordered Lists
• Headings
• Creating new releases

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>127) - sai.msu.ru/ )

• ГАИШ: Государственный астрономический институт имени Штернберга
• GENERAL CATALOGUE OF VARIABLE STARS