In Foswiki, assuming appropriate AccessControls , anyone can change anything but those changes are logged. ... Version . Date of last revision . Person who made change The default PatternSkin offers access to previous versions using the History link in the footer of any viewed topic. ... This topic: System > Contribs > TipsContrib > TipsOfTheDay > TipTopic017 . Topic revision: 18 Aug 2010, ProjectContributor . Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>6304) - wiki.cmc.msu.ru/ )

• PerlDoc < System < Foswiki
• HistoryPlugin < System < Foswiki
• SafeWikiPlugin < System < Foswiki

... NetCDF User's Guide for C . ... more standard error behavior, by uniformly communicating an error status back to the calling program in the return value of each function. ... We are hoping that the benefits of the new interface will be an incentive to use it in new netCDF applications. ... The new interface handles errors differently than netCDF-2. ... Where the netCDF-2 interface used NC_LONG to identify an external data type corresponding to 32-bit integers, the new interface uses NC_INT instead. ...

Еще в разделе: (Показать все результаты (>41) - angel.cs.msu.su/ )

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>189) - www.psy.msu.ru/ )

• Complete list Monographs of the Society for Research in Child Development of

This page demonstrates how to setup a flat calendar. ... The code in this page uses a helper function defined in "calendar-setup.js". ... The positioning of the DIV that contains the calendar is entirely your job. For instance, the "calendar-container" DIV from this page has the following style: "float: right; margin-left: 1em; margin-bottom: 1em". ... You can find the full description of the Calendar.setup() function in the calendar documenation . ...

Еще в разделе: (Показать все результаты (>37227) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (12 vs. 13) - TWiki
• TWikiLoginManagerDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... We obtained 20 complete cytochrome b sequences (1140 bp) of Meles leucurus from the Korean Peninsula (mainland Korea and Jeju Island), Russian Far East, and Mongolia, and these sequences were compared to complete and partial (629 bp) sequences of M. leucurus , obtained from GenBank, in order to reexamine genetic differentiation among M. leucurus from Korea, Siberian and Far-eastern Russia, Mongolia, and China. ...

Еще в разделе: (Показать все результаты (>1138) - zmmu.msu.ru/ )

• Scent marking in gerbils and its possible functions
• Specific functional forms of behavior in pine marten Martes martes, based on
• Genetic and cytogenetic variation of African root-rats Tachyoryctes splendens

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>8) - lhe.sinp.msu.ru/ )

... О UNИX . ... HelpOnXapian . Неизменяемая страница . ... Re-)Building an index . ... Using Xapian you can dramatically improve the performance of searching in moin and furthermore unlock some more features (see the search prefixes above) not possible with the legacy search engine. ... To process attachment files, moin uses filter plugins - here is the list of filter plugins included: . ... Moin will auto disable xapian_search (and fall back to slow search) if it doesn't find a usable index. ...

Еще в разделе: (Показать все результаты (>1867) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/ApacheOnWin32withDomainAuthentication - UNИX
• HelpMiscellaneous/FrequentlyAskedQuestions - UNИX
• Meetings/Murray - UNИX

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>214) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

A stream of data provided to a QNPInstance by the browser. This class is part of the Qt NSPlugin Extension. ... QNPStream  ()  . const char*  url  () const . ... bool  seekable  () const . bool  okay  () const . ... void  requestRead  ( int offset, uint length )  . ... QNPStream  ( QNPInstance *, const char *, _NPStream *, bool )  . ... Creates a stream. ... Returns TRUE if the stream has received all the data from the source. ... Returns the QNPInstance for which this stream was created. ...

Еще в разделе: (Показать все результаты (>823) - rtm-cs.sinp.msu.ru/ )

• What is MICO?
• Apache modules
• Qt Toolkit - QFileInfo member list

... Feature of exciplexes with complete and partial electron transfer formed are analyzed. ... For exciplexes with complete charge transfer (the degree of charge transfer z>0.8 and the energy gap between CT- and LE-states in vacuum (driving force of electron transfer) (H220 - H110) < -0.3 eV), the main contribution to the exciplex energy gives the energy of electron transfer. ... Exciplex energy is substantially lower than that of LE-state even when (H220 - H110) > 0. ...

Еще в разделе: (Показать все результаты (>426) - chem.msu.ru/ )

• Systematical Search for New Types of Chemical Interconversions: Mathematical
• Moscow University Chemistry Bulletin Vol. 56, No. 1, P. 12 (2015)
• Moscow University Chemistry Bulletin Vol. 42, No. 3, P. 194 (2001)

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>190) - www.mce.biophys.msu.ru/ )

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2844) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt

... There are different techniques available that may be used to achieve an effect of focusing of acoustic energy. ... Although such type of array is known, there are comparatively little available experimental data concerning the radiation of finite amplitude wave by it. The aim of the paper is to present results of examination, both experimental and numerical, of the pressure field of the arrays composed of axisymmetric areas of different structure radiating the finite amplitude wave. ...

Еще в разделе: (Показать все результаты (>178) - acs366.phys.msu.su/ )

... What does people think about in my country? ... Some Situations are roots in communism, other are new situations created after 1990. ... In this very moment we have many private schools initiated and supported by many different ONG's. Changing the character of education . ... In Romania we need a different education system, one that is supported by society. ... The ramifications of educations system, based on the needs and the development of the economy as well as social and cultural life, go on. ...

Еще в разделе: (Показать все результаты (>133) - www.prof.msu.ru/ )

• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• A Unique Opportunity for Young Americans and Russians to Volunteer Abroad!
• Training For Effective Intercultural Communication

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>127) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• Lib-DVM. Preliminary design
• Performance Analyzer. Preliminary design

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>1410) - istina.msu.ru/ )

• Plant Signaling and Behavior - журнал | ИСТИНА - Интеллектуальная Система
• Neuroscience and Behavioral Physiology - журнал | ИСТИНА - Интеллектуальная
• Procedia - social and behavioral sciences - журнал | ИСТИНА - Интеллектуальная

Calculation of optimal coefficients for quadrature formulas by the complete enumeration method" . O.V. Belen'kaya, Ya.M. Zhileikin, and A.B. Kukarkin . Optimal coefficients of number-theoretic quadrature formulas are calculated for the two-dimensional case by the complete enumeration method. Optimal coefficients obtained by several different methods are compared. PostScript (in Russian) (87.1KB) . PDF (in Russian) (114KB) . PostScript. zip (in Russian) (30.7KB) . ...

Еще в разделе: (Показать все результаты (>242) - num-meth.srcc.msu.ru/ )

• "Asymptotic behavior of a solution to the Brownian motion"
• "Numerical solution of some spectral problems for the Stokes equations"
• Contents.Volume 4

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>29) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/survey.pdf

Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>199) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Trip over old Shanghai

... In many areas of physics, in particular, in gravitation and quantum field theory, to solve the physical problem one has to find solutions of nonlinear ordinary differential equations or systems of such equations. ... At the same time there exist methods, which allow to find special solutions of systems of ordinary differential equations in the form of elementary or elliptic functions, reducing the initial system to a system of nonlinear algebraic equations. ...

Еще в разделе: (Показать все результаты (>11628) - theory.sinp.msu.ru/ )

• [Comphep-common] comphep error
• Polar vectors
• [RU-NGI] strange behavior of adaptec controller with xfs