The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>179) - hist.msu.ru/ )

• The Savings Behavior of the Russian Population
• Entrepreneurial Behavior of a 17th century Russian Landlord

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>24) - www.cie.ru/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>77) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Research :: :: Research
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

... Earth . Earth, and planetary tectonics . ... Earth, tectonic features of . ... Effective elastic thickness of a plate . ... Elastic deformation . Elastic deformation mechanisms . Elastic deformation, definition of . Elastic deformation, experimental fractures and . ... Elasticity . ... Elasticity, elastic behavior . ... En echelon . En echelon fractures . ... Extension . ... Extension fractures, fracture plane for . ... Extension fractures, vs. shear fractures . ... Extensional . ...

Еще в разделе: (Показать все результаты (>350) - geo.web.ru/ )

• Dictionary_R

Diploma thesis abstract" The experimental investigation of hypersound originated by stimulated Brillouin Scattering process. ... The intensity of scattered beam was detected as a function of the coordinate z along the pumping laser beam direction, which permitted us to detect the intensity of HS as a function of z. The measurements was fulfilled for the different intensities of pump laser beam and for two different focuses lens. ...

Еще в разделе: (Показать все результаты (>75) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Voronov_Ponomarev_en.pdf
• Публикация

... Next: Drawing Curves Up: Cursor modes Previous: Angle measurement Contents Index . The Mode Marks is used to put Marks on the Image. ... If the Numbered field is selected, then the number will appear near each mark. The marks may Arrow-like or V-like. It is possible to remove a mark pointing a cursors at it until red cross (available in Mark Mode) is appear and then click it. ... Next: Drawing Curves Up: Cursor modes Previous: Angle measurement Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>91) - www.spm.genebee.msu.ru/ )

• Videocameras
• Reconstruction of 3D Images

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

... ENDOPHYSICS, TIME, QUANTUM AND THE SUBJECTIVE (With CD-Rom) Proceedings of the ZiF Interdisciplinary Research Workshop Copyright © 2005 by World Scientific Publishing Co. ... 95 CHAPTER I I: TIME The Nature of Time as a Consequence of How We Construct the World Diederik Aerts, Bart D'Hooghe . 113 Time, Memory and Consciousness: A View from the Brain Hans J. Markowitsch . ... 409 On the Sub jective Nature of Relative Frequencies: Combining Special Relativity and Quantum Mechanics Thomas Marlow . ...

Еще в разделе: (Показать все результаты (>410) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/RREPORTS/berkovich_prime_energy.pdf
• http://temporology.bio.msu.ru/discussions/kuznetsov_vremya.pdf
• http://temporology.bio.msu.ru/EREPORTS/correlations.12yr.pdf

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>53) - scon155.phys.msu.su/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>60) - www.msm.biophys.msu.ru/ )

... Sequence entry X56734 (1) has been retrieved from the EMBL Database (2) and showed significant sequence similarity to .. ... accession numbers 44649 2 FTABLE.TXT Feature Table Documentation 465 3 RELNOTES.TXT Release Notes (this document) 915 4 SUBFORM.TXT Data Submission Form 418 5 SUBINFO.TXT Data Submission Documentation 333 6 UPDATE.TXT Data Update Form 107 7 USRMAN.TXT User Manual 1469 8 ACNUMBER.NDX Accession Number Index 8372365 9 CITATION.NDX Citation Index 1872434 ...

Еще в разделе: (Показать все результаты (>166) - www.genebee.msu.ru/ )

• MUSCLE User Guide
• GeneBee
• DIMACS Series in Discrete Mathematics

... Publication data for the ACAT'2002 Proceedings are available (you may download also a Word file ). ... Information on publication of the ACAT'2002 Proceedings and instructions on submission of contributions are available on our Web site. ... Everybody is invited to send interesting pictures! ... Materials (slides etc) of poster presentations appear in our Web data base (check "Programme" page). ... SLIDES of tutorials are available (check "Tutorials" page, then go to particular tutorial page). ...

Еще в разделе: (Показать все результаты (>62) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/plenary.html
• http://acat02.sinp.msu.ru/presentations/gasthuber/presentation.tgif.pdf
• http://acat02.sinp.msu.ru/presentations/severyanov/Severyanov-poster.ps

Press Release . The conference organized by the Centre for Physiology and Biochemical Research (CPBR) was held in Moscow at the Institute of Neurophysiology between 26-28 February 2003. ... Prof. S.B.Seredenin (Moscow) gave a plenary lecture “Biological basis for anxioselectivity” followed by an exciting Psychopharmacology symposium. ... Starting Day 2 of the conference, Prof. M.M.Khananashvili (Moscow) focused on positive impact of informational stress. ... Conference Chair . ... Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>54) - brain.bio.msu.ru/ )

• 8th Multidisciplinary International Conference of Biological Psychiatry "Stress
• Change-points in EEG components with different pattern
• Other prospects of the change-point based analysis

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>333) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Поведенческая медицина (behavioral
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"
• Клуб выпускников МГУ: Кайя Кальпа: продление жизни и бессмертие

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>576) - monkey.belozersky.msu.ru/ )

• DNA/RNA-Protein structures
• Homeodomain numeration assumed
• NPIDB

faq ]] . CompHEP . ... Installation . ... Q: When I try to display squared diagrams for 6 final particles the CompHEP stops . ... Read the FAQ page, . ... Old versions of CompHEP (e.g. 33.23, see the 'Downloads' page) could be installed on HP, SUN and DEC platforms. ... The installation of some versions earlier than 4.4 on 64bit lxplus.cern.ch machines, where 32bit libisajet and libmath from cernlib are found by ./configure in the directory /cern/pro/lib may require the following steps: . ...

Еще в разделе: (Показать все результаты (>21) - comphep.sinp.msu.ru/ )

• news [CompHEP]
• overview [CompHEP]

.

79. Comet Observation Home Page (Chernogolovka)

80. http://www.mgubs.ru/images/Image/courses%20overview%20BA6%20eng.doc