. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>86) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - View Staff

. Parent Directory . 00-index . bullet25.zip . cslio205.zip . db02.zip . dbf2msql-2.0.zip . dbf2mysql-1.10d.zip . dbf_edit1_0.zip . dbffg04b.zip . dbfin096.zip . dbi-1_02.zip . dbv05.zip . mbase205.zip . msql-bench.zip . msql-mysql-modules-1_2010.zip . msql207b1.zip . mysql-c.zip . mysql-client-3.22.26a.zip . mysql2-3.22.26a.zip . odb.zip . os2mb106.zip . postgres652.zip . postgres7.0.0-server-bin_os2.zip . viper092.zip . www-mysql-0.5.7.zip . xdbfj19a.zip

Еще в разделе: (Показать все результаты (>300) - crydee.sai.msu.ru/ )

• Work notes

. The "Areola" system database . Bryzgalov P.A. The paper describes the database of the "Areola" system - a program shell for creating online encyclopedia. In particular, the database structure, the processes of initial data input, detecting errors and editing information in the database are described. PostScript (in Russian) (104KB) . PDF (in Russian) (108KB) . PostScript. zip (in Russian) (30.4KB) . PDF. zip (in Russian) (43KB) . Bryzgalov P.A. e-mail: pyotr777@guru.ru

Еще в разделе: (Показать все результаты (>51) - num-meth.srcc.msu.ru/ )

• "A hybrid database (information system) on the molecular spectral constants"
• "Updatable XML-views over relational databases"
• "Data structuring and formalization in the hybrid database on molecular

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>51) - lnfm1.sai.msu.ru/ )

• Division of the Galaxy and Variable Stars
• Natural Satellites Data Center. Objectiv.

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>21921) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-ruby/database_cleaner/
• Index of /pub/gentoo-portage/dev-python/dj-database-url/
• Index of /pub/gentoo-portage/dev-util/monodevelop-database/

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>9) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>3319) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• allpy: 321c37706049 Makefile

Correlation Engine Portotype V.Pose, JINR Dubna B.Panzer-Steindel, CERN IT Overview The Correlation Engine Prototype was developed during a 3-month work in CERN IT Division financed by the CERN-Intas project. The CERN monitoring prototype, part of the fabric management work package (WP4) of the DataGrid project, gathers monitoring data from farm nodes in CERN into a central monitoring database. ... Two engines are implemented - ayt and procpu. ... connects to such a node using the ayt engine . ...

Еще в разделе: (Показать все результаты (>26) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>33) - comet.sai.msu.ru/ )

• Digitized Sky Engines
• Miscellaneous
• Index of manual pages: A

The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...

Еще в разделе: (Показать все результаты (>112) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf

... TWikiRegistration . To edit pages on this TWikiSite , you must have a registered user name and password. Note: Registered users can change and reset their passwords. ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiRegistration . ...

Еще в разделе: (Показать все результаты (>32768) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• %TOPICTITLE% ( vs. 1) - TWiki
• CGISessionDriverDBIDotPm - TWiki - TWiki

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>76) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>5) - hcs.cmc.msu.ru/ )

• Master program "Network Software" | Магистерское и послевузовское образование

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

37. http://www.inpro.msu.ru/files/do/Minyailov.files/outline.htm

38. http://master.cmc.msu.ru/files/SAP_Lecture_Faerber.pdf

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда