... Data . ... Services . ... Solar energetic particles . ... Neutron flux variations (RU) . Solar flare database (RU) . ... Based on proton measurements onboard GOES and IMP-8, neutron monitor data and GOES X-ray measurements, this database combines information on proton events captured in near-Earth space and their possible solar sources. ... Catalogue of magnetic storms in 1998-2005 based on OMNIweb data with Dst index threshold selection capability. ... Flux intensity is indicated by pixel color. ...

Еще в разделе: (Показать все результаты (>4) - smdc.sinp.msu.ru/ )

... Программа на май 2004 г. 26 мая - два доклада: . ... Error Bounds for Edgeworth and Cornish-Fisher Expansions of MANOVA Test Statistics. ... In this talk we give theoretical accuracy for asymptotic expansions of the distributions of two MANOVA test statistics: . T_{LH}=T_0^2=n \tr S_hS_e^{-1}, \quad T_{LR}=-n \log (|S_e|/|S_e+S_h|), . ... Our main purpose is to derive error bounds for the asymptotic expansions. ... We also discuss about theoretical accuracy for their Cornish-Fisher expansion. ...

Еще в разделе: (Показать все результаты (>27) - new.math.msu.su/ )

• Department of Probability Theory

... A European science agency? Outlook on science policy . ... Vol. ... Ключевые слова: Финансирование образования. ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ЕВРОПА. ... Ключевые слова: Наука в университетах. ... ДРУГИЕ СТРАНЫ ЕВРОПЫ. СТАТЬИ . ... Guildford, 2001. ... Планы финансирования университетов Канады до 2011 г. Ключевые слова: Финансирование образования. ... Трудоустройство выпускников вузов в Великобритании как направление научной политики, 2001 г. Ключевые слова: Трудоустройство выпускников. ...

Еще в разделе: (Показать все результаты (>19) - srcc.msu.ru/ )

• University Information System RUSSIA
• D.D.Sokoloff, Magnetic field reversals in a simple model of geodynamo, Problems
• Moss D., Kitchatinov L.L., Sokoloff D., Reversals of the solar dipole, eprint

... 000todo . 2016-04-08 00:55 . ... 1.0K . ... Apache/2.4.10 (Debian) Server at 127.0.0.1 Port 88 ...

Еще в разделе: (Показать все результаты (>29) - herba.msu.ru/ )

... Sergei A. Astafief Ph.D., associate professor, Economics, Investment Management and Real Estate Management Department, Baikal State University of Economics and Law. ... Various participants of the market, try to solve the problems of construction of a rating of subjects of market economy. One of the responsibilities of Federal Service of Statistics is creating a rating of the enterprises on the basis of the statistical information received from them. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>13) - ee-journal.spa.msu.ru/ )

Testing the hypothesis on the 'drift' of parameters in the moving average model / I. G. Erlikh. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2009. ... Test statistics for checking the conformity of the moving average model to observations are constructed. The statistics are based on sequential processes constructed using residuals and compatible with the equation for estimation of the unknown parameter of the model postulated. ...

Еще в разделе: (Показать все результаты (>5) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

The Status Module is only available in Apache 1.1 and later. The Status module allows a server administrator to find out how well their server is performing. ... The number of children serving requests . ... The status of each child, the number of requests that child has performed and the total number of bytes served by the child (*) . ... Module: mod_status . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>61) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - qcache.h include file
• Qt Toolkit - qdict.h include file
• Qt Toolkit - qintdict.h include file

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

. Home . News . Proceedings . (pub.data ) . Programme (+slides) . Tutorials (+slides) . Participants . Abstracts . Book of Abstracts (PS file) . Photo Gallery . Committees . Topics . HP Grants . Workshop Poster . Inf.Bull. 1 . Inf.Bull. 2 . Inf.Bull. 3 For contacts: . acat02@sinp.msu.ru . Workshop series . ACAT (formerly AIHENP) . Previous Workshop: ACAT2000 .

Еще в разделе: (Показать все результаты (>17) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/tut4.html
• http://acat02.sinp.msu.ru/tutor.html
• http://acat02.sinp.msu.ru/25june.html

This module provides information on server activity and performance. ... Compatibility: Available in Apache 1.1 and later. ... ExtendedStatus To enable status reports only for browsers from the foo.com domain add this code to your httpd.conf configuration file <Location /server-status> SetHandler server-status Order Deny,Allow Deny from all Allow from .foo.com </Location> . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>5) - neptun.sai.msu.ru/ )

• Manual Page: logresolve - Apache HTTP Server

... Resources . ... info@ecfs.msu.ru . All contacts . ... Eurasian Center . for Food Security . ... Comments: 0 . 15 october 2015 . ... Agriculture and the rural sector in general, is a major determinant of livelihoods in Europe and Central Asia (ECA). ... In Central Asia/Caucasus, most of the poor are in rural areas, where agriculture employs half of the population. ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ... Contacts . ...

Еще в разделе: (Показать все результаты (>59) - ecfs.msu.ru/ )

• Login | ECFS
• Dosov Botir | ECFS
• Parikh Alka | ECFS

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>18) - brain.bio.msu.ru/ )

... Statistics in Medicine [Stat Med] . Common information . ... no information] . ... 0277-6715 . ... since 1982-01-01 till today . ... subscription - $3270,single article - $32 . ... medicine . ... http://www3.interscience.wiley.com/cg.. ... 1982-01-01 . today . ...

Еще в разделе: (Показать все результаты (>11) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>2) - suny.msu.ru/ )

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Еще в разделе: (Показать все результаты (>5) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N
• AUTHOR : Sophocleous C

. WWW Statistic . Postgraduate student of 1 year of Institute of Astronomy of Russian Academy os Sciences . Young reseacher of Astronomical Division . ( Sternberg Astronomical Institute ) . Faculty of Physics . Moscow State University . Observer of student's astronomical observatory . Programmer of the NEXT Company .

Еще в разделе: (Показать все результаты (>10) - comet.sai.msu.ru/ )

• Courses
• What is the history of this file?

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>19) - sp.cs.msu.ru/ )