extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>20) - comphep.sinp.msu.ru/ )

• news [CompHEP]

... Кустов М.Л., проф., д.х.н. This original course of lectures in English represents a survey of modern trends in chemistry, including: . Application of principles of 'green' chemistry in the synthesis of organic and iorganic products, including nanomaterials, for instance the synthesis of less toxic nanomaterials, . ... Non-traditional methods of performing the chemical processes of synthesis of organic and inorganic products (microwave activation, low-temperature plasma), . ...

Еще в разделе: (Показать все результаты (>618) - chem.msu.ru/ )

• Molecular Structure and Physicochemical Properties of Acetone-Chloroform...
• Moscow University Chemistry Bulletin Vol. 48, No. 4, P. 230 (2007)

Next: SYSTEM CALL: msgctl() Up: 6.4.2 Message Queues Previous: SYSTEM CALL: msgget() . ... To deliver a message to a queue, you use the msgsnd system call: . ... The first argument to msgsnd is our queue identifier, returned by a previous call to msgget . ... The msgsz argument contains the size of the message in bytes, excluding the length of the message type (4 byte long). ... The fourth argument ( mtype ) specifies the type of message to retrieve from the queue. ...

Еще в разделе: (Показать все результаты (>610) - itpm.msu.su/ )

• All About ifconfig
• Ethernet Autoprobing
• Configuration Files - Apache HTTP Server

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>27) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE - Centre for Photonuclear Experiments Data - Home page

The old base model for VES data interpretation was horizontally-layered medium. We consider as the new base model ( fig.1 ) a combination of horizontally-layered structure (HLS) , deep inhomogeneities (DI) (3-4 on fig.1) and nearsurface inhomogeneities - NSI (1-2 on fig.1). TES field technology includes the next rules: . ... In turn AO max depends on depth of investigation h max . ... These effects depends also on the fact: is this dipole group or single electrode moveable or unmoveable. ...

Еще в разделе: (Показать все результаты (>66) - geophys.geol.msu.ru/ )

• Anis. Page2

'mpif.h' * Именованные константы - параметры задачи INTEGER DLEN_, IA, JA, IB, JB, M, N, MB, NB, RSRC, $ CSRC, MXLLDA, MXLLDB, NRHS , NBRHS, NOUT , $ MXLOCR, MXLOCC, MXRHSC PARAMETER ( DLEN_ = 9, IA = 1, JA = 1, IB = 1, JB = 1, $ M = 9, N = 9, MB = 2, NB = 2, RSRC = 0, $ CSRC = 0, MXLLDA = 5, MXLLDB = 5, NRHS = 1, $ NBRHS = 1, NOUT = 6, MXLOCR = 5, MXLOCC = 4, $ MXRHSC = 1 ) DOUBLE PRECISION ONE PARAMETER ( ONE = 1.0D+0 ) * * Локальные переменные INTEGER ICTXT , ...

Еще в разделе: (Показать все результаты (>527) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/meth_mat/parl_prg/pr2_3.htm

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>27) - analyt.chem.msu.ru/ )

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>142) - www.genebee.msu.ru/ )

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>103) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/m44_70_pugacheva.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms38/ms080.pdf
• Svetlana G. Pugacheva

... Data . ... Models . ... Paraboloid model . ... Dynamic paraboloid model (A2000) allows to calculate the variations of magnetic field of each magnetospheric large scale current systems by empirical data during quite and disturbed periods. ... The IMF penetrated into the magnetosphere as well as field-aligned currents magnetic field are included in the total magnetospheric magnetic field. ... bb(2,i) - ring current magnetic field; . ... BD is the geomagnetic dipole magnetic field at the Earth's...

Еще в разделе: (Показать все результаты (>36) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• IGRF10 model - Space monitoring data center

... help . find changesets by author, revision, files, or words in the commit message hg locate [OPTION].. PATTERN]... locate files matching specific patterns Print files under Mercurial control in the working directory whose names match the given patterns. By default, this command searches all directories in the working directory. ... If no patterns are given to match, this command prints the names of all files under Mercurial control in the working directory. ...

Еще в разделе: (Показать все результаты (>21230) - kodomo.fbb.msu.ru/ )

• allpy: 2e9cbe32a554 debian/rules
• allpy: debian/rules annotate
• allpy: 8a81996f8bda debian/rules

... GENERAL INFORMATION Registration Registration forms will be available in January 2010 at: 20th Polymer Networks Group Meeting in Goslar , Germany, Aug. 29th ґ Sep. 2nd, 2010 Invited speakers (CEN Saclay, France) FranГois BouИ (CU Boulder, USA ) Christopher N. Bowman (University of Cambridge, UK) Wilhelm Huck (UDEL Newark, USA ) Kristi L. Kiick (UNC Chapel Hill, USA ) Michael Rubinstein (IPF Dresden, Germany) Jens-Uwe Sommer (UW Seattle, ... chemically reversible networks, ! ...

Еще в разделе: (Показать все результаты (>187) - polly.phys.msu.ru/ )

• LCOptimizer Software
• International Workshop "Theory and Computer Simulation of Polymers: New

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ?GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY? aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>215) - www.geogr.msu.ru/ )

• ГРАНТЫ НА ПРОВЕДЕНИЕ ИССЛЕДОВАНИЙ НА АЛЯСКЕ

... Nonlinear FDTD-Modeling of Ultrasound Thermotherapy Including Temperature Dependent Tissue Parameters . ... It strongly depends on the counteracting processes of nonlinear ultrasound propagation and tissue attenuation. ... The temperature dependence of tissue parameters is taken into account for the complete model. ... Furthermore it is demonstrated that the temperature dependence of tissue parameters can not be neglected for accurate predictions of the required heating time. ...

Еще в разделе: (Показать все результаты (>238) - acs366.phys.msu.su/ )

• AUTHOR : Riedlinger R
• AUTHOR : Ginter S
• AUTHOR : Dreyer T

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>66) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/accomod.html
• http://acat02.sinp.msu.ru/presentations/brun/Solutions_2.doc
• http://acat02.sinp.msu.ru/form/hotel_form.doc

Text can be included in the shell script by using a here document, a special form of input redirection. The << symbol is used to indicate that text should be read up to a given mark. For example: #!/bin/sh # this script outputs the given text before it runs cat << EOF This shellscript is currently under development, please report any problems to Danny (danny@cornflake.ed) EOF exec /usr/local/test/bin/test_version . ...

Еще в разделе: (Показать все результаты (>215) - comet.sai.msu.ru/ )

• Command substitution
• Location of the kernel file
• Examples of using UNIX shell commands

... Scope of Directives .htaccess Files . ... Apache is configured by placing directives in plain text configuration files. ... Any directive may be placed in any of these configuration files. ... Apache configuration files contain one directive per line. ... Directives placed in the main configuration files apply to the entire server. ... The server administrator further controls what directives may be placed in .htaccess files by configuring the AllowOverride directive in the main configuration files....

Еще в разделе: (Показать все результаты (>118) - neptun.sai.msu.ru/ )

• Configuring Multiple IP Addresses
• How Directory, Location and Files sections work
• Issues Regarding DNS and Apache

... MPI. ... 2 10 Message passing = + Process 0 Data ? ... 0 1 2 MPI- : np ґ rank [0 ... np-1] ґ " ", 2 13 13 MPI MPI . ... MPI_ANY_TAG. ... MPI _Send(buf, count, datatype , dest, tag , comm ) Address of Datatype of Message tag send buffer each item Number of items Rank of destination Communicator to send process , 2 41 MPI () Receive MPI _RECV(buf, count, datatype , source , tag , comm , status ) , source tag source ґ MPI _ANY_ SOURCE . comm status MPI _Recv(buf, count, ...

Еще в разделе: (Показать все результаты (>94) - angel.cs.msu.su/ )

• Summary

... Further processing Only 3N events of ?good? runs of previous analysis are selected: 3N triggered events exist in every run Better accordance with MC for rates 150kHz (see elog 548 by Colas) GC triggered events excluded AaFit: -6.5 (Vladimir's presentation explains reason) Zenith angle 20° (in order to look only at events with vertical tracks) After 2008 2009 2010 all fi year year year ltres: -- 0.83107 -- 0.77107 -- 1.04107 - No evidence of possible anisotropy either. ...

Еще в разделе: (Показать все результаты (>20) - antares.sinp.msu.ru/ )

... All circuit parameters have been presented in a symbolic form. ... To use the program you will need a CIR file (PSpise, DesignLab file) of your circuit. CIR file examples have been enclosured: bpasside.cir, test1.cir, test2.cir, test3.cir, test4.cir, laksamp.cir, bridge.cir, uA741acf.cir, quartz.cir. ... Ideal operational amplifier (nullor) * Nname n1 n2 n3 n4 * * In the ideal op amp data, (n1,n2) represent output nodes, * (n3,n4) represent input nodes (noninverting, inverting). ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Symbolic matrix processor