... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease , ). ...
[
Текст
]
Ссылки http://www.soc-phys.chem.msu.ru/rus/prev/zas-2015-12-01/presentation.pdf -- 1351.3 Кб -- 25.12.2015 Похожие документы
... 29 мая 2008 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую программу "Арии, романсы русских и зарубежных композиторов" в исполнении студентов, аспирантов, преподавателей и выпускников МГУ. ... Полную версию программы концерта можно посмотреть здесь. 25 мая 2007 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую концертную программу. ... Начало концерта в 19.00 в фойе КЦ МГУ . ... Вокальный класс КЦ МГУ . ... Вокальные События в КЦ МГУ . ...
... О факультете | ... Структура факультета . ... Научная жизнь . ... 495) 939-4461 . 495) 939-3749 . ... Виталий Третьяков считает, что телевидение должно иметь 'книжный фундамент', то есть опираться на традиционные культурные ценности человечества.. ... Новая жизнь нашей телестудии . ... Наша телевизионная студия начала новую жизнь! ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... The Faculty of Materials Science General Information . ... Students complete a number of special theoretical and practical training courses with the best MSU professors to have advanced training in mathematics, chemistry, physics and mechanics. ... Such a small student admission is a deliberate choice intended on individual training program for each student. The main advance in education is extensive emphasis on research and creativity that facilitates scientific results of the students. ...
... Author: Гаина Алексей . Subject: HISTORY of ASTRONOMY: V.A. ALBITZKY(Russian and English) . ... Nachr., ... 1928, Izvestia GAO Poulkovo, Vol. ... 1941, Izvestia KrAO, vol. ... KrAO, vol. ... 1947, Izvestia KrAO, vol. ... KrAO . ... Subject: 20-летие школы "Квантовые частицы в интенсивных полях" . ... 3 мая исполняется 20 лет со дня открытия в Молдавии школы молодых ученых "Квантовые частицы в интенсивных полях". История школы такова: . ... 4 мая, утро . ... Кууск П. 7 мая, утро . ...
International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...
[
Текст
]
Ссылки http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc -- 215.0 Кб -- 19.03.2014 Похожие документы
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
... - профессор Р.А.Васин ї Механико-математический факультет МГУ, 2011 г. СОДЕРЖАНИЕ Цель работы 4 Введение 4 Теоретические основы метода 5 Анализ распространения света в полярископах 9 Оптическая схема полярископа БПУ (ИМАШ-КБ-2) 15 Примеры применения метода фотоупругости 16 Определение компонент тензора напряжений в плоской модели 21 Порядок выполнения и оформления работы 25 Вопросы к зачету по практикуму 26 Литература 27 Поляризационно-оптический ... Теоретические основы метода. ... pic]...
[
Текст
]
Ссылки http://elast.math.msu.su/Sites/companysite/Uploads/photoelast.A8AD628B07254896BF64C03441EEC9A6.doc -- 996.5 Кб -- 15.09.2011 Похожие документы
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...
... О факультете | ... Структура факультета . ... Образовательные программы . ... Программы курсов . ... Власти Китая разрешат спутниковым телеканалам покупать права на показ только одной иностранной программы в год. Такое решение принято в рамках политики укрепления морали и популяризации образовательных программ на китайском телевидении. ... Китайские власти также ужесточают законы, касающиеся Интернета. ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
JOURNAL OF APPLIED PHYSICS 100, 033718 2006 Transition between N- and Z-shaped current -voltage characteristics in semiconductor multiple- quantum - well structures O. V. Pupyshevaa Institute for Materials Research, Tohoku University, Sendai 980-8577, Japan and Department of Low Temperature ... -8577, Japan Received 17 January 2006; accepted 17 June 2006; published online 14 August 2006 We study theoretically the vertical electron transport in semiconductor multiple- ... Phys. Lett. ...
... Студенты, аспиранты и докторанты кафедры занимаются по индивидуальным планам. ... Имеется большой выбор специальных курсов для студентов и аспирантов. Студенты 3-го курса проходят физико-механический практикум в филиале кафедры - Центральном Научно-исследовательском институте специального машиностроения. Каждый студент 3-го курса (а желающие и со 2-го курса) имеет собственного научного руководителя и работает в одном из специальных семинаров кафедры, пользуется советом куратора. ...