... Форумы > Аспирантура > Тема . ... PhD position in the University of Florida . PhD position is available in the department of Industrial and Systems Engineering, University of Florida. ... Risk Management and Financial Engineering Lab website: http://www.ise.ufl.edu/rmfe/ . ... Statistical estimation in terms of factor models can be tuned to risk preferences in order to achieve better performance when applied to portfolio optimization. ... University of Florida, November 2011. ...

Еще в разделе: (Показать все результаты (>92) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантская вакансия: байесовский анализ в
• MMOnline | Форумы | Разное | предложение о работе
• MMOnline | Форумы | Книжная барахолка | Ищу: Knuth, Donald E. Selected Papers

Effective Algorithm of Charge State Determination in Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectra of Humic Substances Erast V. Kunenkov1, Andras Gaspar2, Alexey S. Kononikhin3, Philippe Schmitt-Kopplin2, Irina V. Perminova1 ... ESI FTICR mass spectrum of HS contains about ten thousands of peaks in mass range 250­1200 Da (the most intensive peaks are usually located near 400 Da) with tenths of peaks, appeared at each nominal mass with high regularity. ...

Еще в разделе: (Показать все результаты (>120) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-vladimirov-combination.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-kunenkov-total.pdf
• http://www.mgumus.chem.msu.ru/ihss-14/docs/IHSS-08-Proc-vol-03.pdf

... Work of a system constructing the exercises with the help of a teacher is described. Algorithms of fragmentation of sound data into phonemes and of analysis of correctness of pronunciation of a student are suggested. ... The authors offer the functioning variant of a system, making it possible to a student to appreciate objectively a degree of correctness of his pronunciation, to classify errors and to listen to a difference of pronunciations of incorrect sounds interactively. ...

Еще в разделе: (Показать все результаты (>110) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Research

... Physics Department . ... Home :: Directions of Research :: General Approaches to Statistical Thermodynamics of Copolymers of Practical Importance (theory) Phase diagrams of solutions, melts and blends consisting of copolymers obtained during realistic polymerization processes. ... Miscibility Maps and Blends Containing Statistical Copolymers. ... Home :: Directions of Research :: General Approaches to Statistical Thermodynamics of Copolymers of Practical Importance (theory) . ...

Еще в разделе: (Показать все результаты (>196) - polly.phys.msu.ru/ )

• Microphase Separation, Formation of Other Microstructures in Polymer Systems -
• Publications
• seminars

Name Last modified Size Description . Parent Directory - _vti_cnf/ 30-Oct-2012 12:19 - filelist.xml 26-Nov-2003 00:39 163 image001.gif 26-Nov-2003 00:39 5.3K . Apache Server at genphys.phys.msu.su Port 80

Еще в разделе: (Показать все результаты (>32) - genphys.phys.msu.su/ )

• Index of /rus/edu/kvant/II_2/STAT2/_private/Statistic.files/_vti_cnf

The Journal "Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...

Еще в разделе: (Показать все результаты (>123) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... Геология >> Информационные технологии | ... Программа ищет и показывает закономерности в организации линейных элементов дистанционных данных. ... С не меньшим основанием можно анализировать рисунок хребтов и долин в цифровых моделях рельефа (ЦМР). ... И, наконец, LESSA позволяет анализировать бинарные схемы полученные любым другим путем, например, схемы ручного дешифрирования линеаментов, схемы гидросети и т.д. ( подробности на сайте http://www.lineament.ru ) . ...

Еще в разделе: (Показать все результаты (>459) - geo.web.ru/ )

• Untitled Document
• Авторский сайт Владимира Мальцева - литература

Measurements of B р Xsl+l- and BрK(*) l+l- at Belle A. Ishikawa (KEK) 18, Aug, 2004 32 nd International Conference on High Energy Physics BICC, Beijing, China Introduction n bрs l+l Е Е Е Е - Е First observed by Belle in BрKll Proceed through penguin, Z penguin and W box diagrams Sensitive to new physics Sign of Wilson coeffient C7 as well as C9 and C10 can be obtained from q2 distribution and AFB(q 2). ... Four background sources Е Е Е Е dilepton events from continuum, mostly from charm events. ...

Еще в разделе: (Показать все результаты (>183) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/epp10/Polyakov.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/240809/Palladino.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Chekhtman.pdf

Determination analysis as a method for diagnostics of ecosystem condition . ... It is capable effectively to work with variables which distribution is not normal, and also with qualitative variables, it is not sensitive to availability of zero values in arrays of data. ... With the help of DA the solving of problem of ecological standardization is possible, i.e. determination of ranges of environmental factors values at which condition of different parts of biota is ecologically satisfactory. ...

Еще в разделе: (Показать все результаты (>528) - chronos.msu.ru/ )

Next: Stringified Object References Up: Sample Program Previous: MICO application . CORBA would be pretty useless if you always had to run the object implementation ( server ) and the client that uses the server in the same process. Here is how to separate the client and server parts of the example in the previous section into two processes running on the same or on different machines . ... Stringified Object References . ... The MICO Binder (CORBA Extension) . ...

Еще в разделе: (Показать все результаты (>358) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_imap
• Apache module mod_dir
• Dynamically configured mass virtual hosting

... Administrative problems: theory and practice . ... Astrhancev C.E. Institutional Peculiarities of Government-owned Shareholdings Management . ... Solodov V.V. Simulations in Anticorruption Policy Models . ... Toshenko V.V. Stages of Transition to Sustainable Development Based on Public-private Partnership . ... Legal and political aspects of public administration . ... Oskanova Z.I., Nakashidze B.J. The Concept of 'Institutes of Democracy in the Russian Federation' and its Formation . ...

Еще в разделе: (Показать все результаты (>183) - ee-journal.spa.msu.ru/ )

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>24) - www.mse-msu.ru/ )

Limits on anomalous Wtb couplings in single top - quark events in the CMS experiment Georgii Vorotnikov SINP MSU on behalf of the CMS Collaboration QFTHEP'15 26 June 2015 Anomalous coupling in Wtb vertex General form of the effective Wtb vertex lagrangian: 2 Where q' q + f ,f fT ,f L L V R V R T ­ Left and right vector couplings ­ Left and right tensor ...

Еще в разделе: (Показать все результаты (>147) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/QFTHEP%20-%20Myagkov.pdf
• http://qfthep.sinp.msu.ru/proceedings2015/Bound_Yazkov.pdf
• http://qfthep.sinp.msu.ru/talks/RussoQFTHEP2010.pdf

Prediction and analysis of separated restriction-modification systems in prokaryotic genomes. ... 36, 1, Moscow, 117281, 5Lomonosov Moscow State Prokaryotic restriction-modification (R-M) systems defend host cell from invasion of a foreign DNA. ... However, in Restriction Enzyme database (REBASE, http://rebase.neb.com) we found 272 solitary restriction endonuclease genes, i.e. genes of putative restriction endonucleases without nearly located genes of DNA methyltransferase. ...

Еще в разделе: (Показать все результаты (>292) - mccmb.belozersky.msu.ru/ )

• MCCMB'11 posters

... Лекторий по физике . ... Наш факультет . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра квантовой статистики и теории поля . ... Разработанные им асимптотические методы могут применяться к уравнениям, возникающим в разных областях науки: квантовой механике, теории поля, статистической физике, абстрактной математике. ... В области статистической физики развиваются различные применения методов квантовой теории поля к статистическим системам (проф. Б.И. Садовников...

Еще в разделе: (Показать все результаты (>4141) - phys.msu.ru/ )

• Title

Автор: Юрий Тукачев . ... Официальные русскоязычные руководства пользователя по IBM SPSS Statistics 20 (в формате PDF): . Руководство пользователя по базовой системе IBM SPSS Statistics 20 . Руководство пользователя по функционалу базового модуля IBM SPSS Statistics Base 20 . ... Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... Флогистон / психологический блог / Руководства пользователя на русском языке по IBM SPSS Statistics 20 . ... 2 Константин Ефимов . ...

Еще в разделе: (Показать все результаты (>175) - www.flogiston.ru/ )

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>23) - hit-conf.imec.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

The Journal "Vestnik Moskovskogo Universiteta. ... Matematika. Mekhanika" is a periodical scientific publication that reflects the topics of the important directions of theoretical studies in mathematics and mechanics in the M.V. Lomonosov Moscow State University. ... The Founders of the Journal "Vestnik Moskovskogo Universiteta. ... Mekhanika" are the M.V. Lomonosov Moscow State University and the Faculty of Mechanics and Mathematics . ... Faculty of Mechanics and Mathematics . ...

Еще в разделе: (Показать все результаты (>96) - new.math.msu.su/ )

• Department of Probability Theory
• A.Yu. Veretennikov

e-mail: viverhovin@yandex.ru) , , , corruption, the western enforcement system, corruption scandals, statistics of corruption in the western countries . ... Analysis and criticism of some apologetics examples of the western market society, not capable to minimize corruption at different levels of its organization is given. Necessary statistical and actual arguments in favor of the author's viewpoint are resulted. ...

Еще в разделе: (Показать все результаты (>59) - vestnik.socio.msu.ru/ )