... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>172) - www.genebee.msu.ru/ )

• GEA :: Gene Expression Analysis

Next] [Previous] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . ... The purpose of the Network Common Data Form (netCDF) interface is to allow you to create, access, and share array-oriented data in a form that is self-describing and portable. ... Using the netCDF interface in software for data access, management, analysis, and display can make the software more generally useful. The netCDF software includes C and FORTRAN interfaces for accessing netCDF data. ...

Еще в разделе: (Показать все результаты (>34) - angel.cs.msu.su/ )

• Appendix D NetCDF 2 C Transition Guide
• Foreword
• : Interface Logger

... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...

Еще в разделе: (Показать все результаты (>10) - anazarenko.ffl.msu.ru/ )

... Supercomputer molecular modeling of thermodynamic equilibrium in gas-metal microsystems" . Podryga V.O., Polyakov S.V., and Puzyrkov D.V. This paper is devoted to the supercomputer modeling of thermodynamic equilibrium in microsystems containing different substances in various aggregate states. ... Podryga V.O. тАУ Keldysh Institute of Applied Mathematics, Russian Academy of Sciences; Miusskaya ploshchadтАЩ 4, Moscow, 125047, Russia; Ph.D., Scientist, e-mail: pvictoria@list.ru . ...

Еще в разделе: (Показать все результаты (>236) - num-meth.srcc.msu.ru/ )

• "Numerical aspects of the calculation of scaling factors from experimental...
• "A quasi-3D model of a polymer electrolyte fuel cell"
• Numerical Methods and Programming.Advanced Computing

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>195) - www.mmonline.ru/ )

• MI RAN, Alexeyev Conference, 23-28 December
• MMOnline | Развлечения | Эволюция Программиста
• MMOnline | Новости | Эволюция Программиста

... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...

Еще в разделе: (Показать все результаты (>130) - monkey.belozersky.msu.ru/ )

• SDPpred
• 1FJL biounits
• HF clusters: algorithm

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>66) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/brun/Solutions_2.doc
• http://acat02.sinp.msu.ru/accomod.html
• http://acat02.sinp.msu.ru/presentations/brun/Exercises_2.doc

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...

Еще в разделе: (Показать все результаты (>36) - www.lssm.inorg.chem.msu.ru/ )

The old base model for VES data interpretation was horizontally-layered medium. We consider as the new base model ( fig.1 ) a combination of horizontally-layered structure (HLS) , deep inhomogeneities (DI) (3-4 on fig.1) and nearsurface inhomogeneities - NSI (1-2 on fig.1). TES field technology includes the next rules: . ... In turn AO max depends on depth of investigation h max . ... These effects depends also on the fact: is this dipole group or single electrode moveable or unmoveable. ...

Еще в разделе: (Показать все результаты (>76) - geophys.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Anis. Page2
• Geophysical department at Moscow University

Clitic doubling in a determinerless language with second position clitics Introduction: Clitic doubling, a phenomenon where an argument of the verb is doubled by a corresponding clitic, as in (1), is known from many languages, which all seem to share (at least) two things: they all have verb adjacent clitics and they all have determiners. ... Generality of clitic doubling in GoS: Clitic doubling in Gorica Slovenian is limited to pronouns, i.e., only pronouns are doubled by a corresponding clitic. ...

Еще в разделе: (Показать все результаты (>281) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html
• MSCL-3 | Call for Papers
• LangueDOC :: Khinalug :: Alphabet

About That Humics Joe Bloggs1, John Doe2, Juan Perez3 1Institute for Humic Materials, City, Country, JoeBloggs@humic.edu 2University of Humics, City, Country 3Academy for Humic Design, City, Country Please prepare your abstract according to this template using provided styles: AbstractTitle, AbstractAuthors, AbstractAffiliation, AbstractText, AbstractFigure, AbstractTableName. The abstract can be one page or two pages (author's choice) including figures and tables. ... File size |Maximum 5 Mb | ...

Еще в разделе: (Показать все результаты (>135) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/hit-2010/docs/abstract_template%5BHIT-2010%5D.doc
• http://www.mgumus.chem.msu.ru/hit-2012/docs/abstract_template%5Bhit-2012%5D.doc
• MGUMUS -- First International Conference on Humics-based Innovative

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

What would you like to search for? ... Case sensitive Match whole word Recent publications first . ... What to do if you are looking for ... words iron and oxide in the same record: iron and oxide . both these words or chemical formulae: (iron and oxide) or Fe2O3 . ... That's why do not use Co instead of cobalt : you will find Co even in al co hol! ... The hidden part of the database allows you to use full names of chemical elements instead of the short ones (like nickel instead of Ni ). ...

Еще в разделе: (Показать все результаты (>5) - scon155.phys.msu.ru/ )

... About lab . ... The LidarK library provides an open-source framework for processing multidimensional point data such as 3D LIDAR scans. ... Download LidarK 2.0 , or browse for the previous versions and data samples . ... We called the data structure we designed Seg-Tree . ... GML LidarK Library v. 2.0 September 10, 2010 Download . GML LidarK Library v. 1.2 December 5, 2008 Download . GML LidarK Library v. 1.1 September 9,2008 Download . GML LidarK Library v. 1.0 July 1, 2008 Download . ...

Еще в разделе: (Показать все результаты (>269) - graphics.cs.msu.ru/ )

• Image-based 3D reconstruction of urban scenes | Graphics and Media Lab
• GML LidarK Library | Лаборатория компьютерной графики и мультимедиа
• Road monitoring | Graphics and Media Lab

This group allows you to probe a potential energy surface along a grid of points. The scan can be made for any SCFTYP, or for the MP2 or CI surface. IVEC1 = an array of two atoms, defining a coordinate from the first atom given to the second. ... DISP1 = step size for the coordinate. ... Press to view sample input file for GAMESS (US) style relaxed scans using DLCs . ... Download Firefly-specific samples on scans over internal coordinates using DLCs . ... New MP2 gradient code documentation . ...

Еще в разделе: (Показать все результаты (>115) - classic.chem.msu.su/ )

• Firefly for Mac OS X: main page
• Just CUDing: Firefly v. 7.1.G standard MP4(SDTQ) benchmark on NVidia GPUs or
• Lesson 3: two methods for preparing Firefly' input files with basis sets and

... Next: Index Up: Scanning Probe Microscopy Image Previous: COM-port initialization file format Contents Index . Figure D.1: Parameters of 3D Images . ... Intensity of material emission (Mat. ... material color for diffused light (Mat. ... material reflection color for directed light (Mat. ... material reflection color for reflected light (Mat. ... intensity of directed light (Light Diffuse) . ... Material Shininess) In our case we use the model, where , and this parameter is called Material Color. ...

Еще в разделе: (Показать все результаты (>132) - www.spm.genebee.msu.ru/ )

• AFM examination of TMV and virion RNA
• Hysteresys calibration file generation
• Median filtering

... XIV International Ornithological Conference of North Eurasia . ... ABSTRACTS GUIDELINES . ... Program Committee makes a decision on including the contributed abstracts into the program of the conference and edits a book of abstracts. In case of refusal of the contributed abstracts, Program Committee informs the chief author on the fact individually. ... Abstracts with the proposed status of the presentation (sectional presentation or poster) should be submitted up to 20 December 2014 . ...

Еще в разделе: (Показать все результаты (>1314) - zmmu.msu.ru/ )

• Murina - Tube-nosed bats
• RAPDs in representatives of the genus Sorex, including chromosome races of
• Plecotus - Long-eared bats

To see a Russian version of this page, click here . ... Graduated from Moscow State University (MSU), Faculty of Physics in 1976. Ph.D. degree - 1988, MSU. Main field of scientific activities: photometric investigations of various stars, close binary stellar systems and other astronomical objects, including research with use of fast photoelectric photometry with a high time resolution till 1 millisecond. ... New portable photometer . ... Send your mail to: tem@sai.msu.ru ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Irina Glushneva
• Tatjana Khruzina

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>211) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/154.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/163.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf

The conference "Human Rights in Russia: the past and the present" was held in Perm city on the 21 st - 23 rd of June. Different scientists, human rights activists, teachers of human rights, including the participants of the Russian - American exchanges took part in the conference. ... The representative of the president of Russia G. A. Zaitzev, vice - governor V.G. Sergeev, vice - mayor of Perm city O.M. Zdanov opened the conference with the greeting. ...

Еще в разделе: (Показать все результаты (>117) - www.prof.msu.ru/ )

• Conflict Transformation, Ngo And Networking
• SELF-DISCOVERY, DIVERSITY, FLEXIBILITY AND ACADEMIC EXELLENCE IN THE CONTEXT OF
• Ensure your inclusion in the Dissertations in Central Asian Studies Webpage