Theoretical Department of the Institute of Electrochemistry AN USSR . ... Yuri A. Chizmadgev - Frumkin Institute, Moscow . Boris M. Grafov - Frumkin Institute, Moscow . Vladislav Yu Filinovskiyi - Frumkin Institute, Moscow . Semen I. Kuchanov - Moscow University (Dept of Physics) and Nesmeyanov Institute, Moscow . ... Michael I. Urbakh - Tel-Aviv University, Tel-Aviv . Yuri G. Chirkov - Frumkin Institute, Moscow . ... Igor G. Medvedev - Frumkin Institute, Moscow . ...

Еще в разделе: (Показать все результаты (>98) - electr003.chem.msu.ru/ )

• RADEN Data Bank
• Liana N. Sviridova:CV
• Evgeny V. Antipov:CV

Preliminary list of participants . ... Organization (Institution) . ... Saint Petersburg State University . ... SINP MSU . ... Saint-Petersburg State University, Faculty of Physics . ... Institute for Nuclear Research . ... Faculty of Physics M.V.Lomonosov Moscow State University . ... Skobeltsyn Institute of Nuclear Physics, M.V. Lomonosov Moscow State University . ... Skobeltsyn Institute of Nuclear Physics of Moscow State University . ... D.V. Skobeltsyn Institute of Nuclear Physics, MSU . ...

Еще в разделе: (Показать все результаты (>248) - qfthep.sinp.msu.ru/ )

• INFORMATION BULLETIN No.1
• Bulletins
• QFTHEP

Pod-Moscowny . Moscow-Regional) . Branch . ... Moscow State University . Page in Russian . Moscow-Regional Branch of M.V.Lomonosov Moscow State University was founded in 1996 in Chernogolovka , town for science and education, placed in 40 km to the North-East from Moscow-city border. Chernogolovka today is considered to be one of the most important Russian scientific and educational centers in physics and chemistry . ... Branch of Moscow State University, . ... Russian Federation . ...

Еще в разделе: (Показать все результаты (>34) - www.issp.ac.ru/ )

• High Education in ISSP PAS, Chernogolovka
• Institutes of Chernogolovka

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>307) - astro.uni-altai.ru/ )

• Новости науки
• Kiev University Observatory

... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТљMechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТљMechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТљthe Education ofТљthe Russian Federation . ... since 2003: Head ofТљDepartment ofТљMechanics, Steklov Mathematical Institute, Russian Academy ofТљSciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>224) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Staff
• Institute of Computer Sciences - Staff - Karavaev Yury L.

Associate professor in Historical Information Science Department of the History Faculty MSU (since 2007, Research Fellow since 1998). PhD in Russian social history (2005). ... Post-doc Researcher at the Department of Economic & Business, Pompeu Fabra University, Barcelona (November 2006) and at the Department of Economic History, School of Economics and Management, Lund University (May-July, 2007). ... Internet Resources on Russian History: the Electronic Library at Moscow State University. ...

Еще в разделе: (Показать все результаты (>389) - hist.msu.ru/ )

• Moscow Lomonosov State University. History. Departments
• Cambridge University Press. Economic History. 1997
• Department of Ancient History

Moscow State University . Physics Department . ... Home :: History of Research :: History of Research in Polymer Physics at the Physics Department of Moscow State University . ... Studies in polymer theory were initiated at the Physics Department of Moscow State University by Professor I.M.Lifshitz (1917-1982). ... A.Yu.Grosberg, I.Ya.Erukhimovich and A.R.Khokhlov were among his first students. ... Grosberg, A.R. Khokhlov. ... Statistical Theory of Polymeric Lyotropic Liquid Crystals. ...

Еще в разделе: (Показать все результаты (>526) - polly.phys.msu.ru/ )

• Main - Chair of Polymer and Crystal Physics
• P.N.S.P.M. Lab. - Collaboration
• Seminar in Polymer Physics - 1998

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>95) - qilab.phys.msu.ru/ )

... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...

51. Organizing Committee International Conference Differential Equations and

52. Presentations and Lectures

53. About Lomonosov Moscow State University :: CIE

54. Conductor | Academic choir of Moscow State University

55. XIV International Ornithological Conference of North Eurasia: Organizers

56. International Collaboration

57. Обсерватория

58. Graphics and Media Lab | CMC department, Lomonosov Moscow State University

59. A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:

60. Marat Abubekerov - My university years