arxiv:1206.4718 Kepler-36: пара планет с близкими орбитами, но сильно различающимися плотностями (Kepler-36: A Pair of Planets with Neighboring Orbits and Dissimilar Densities) . Authors: Joshua A. Carter et al. arxiv:1206.2834 NGC 1624-2: медленно вращающаяся яркая в рентгене Of?cp звезда с необычно мощным магнитным полем (NGC 1624-2: A slowly rotating, X-ray luminous Of?cp star with an extraordinarily strong magnetic field) . ... Authors: Fermi-LAT Collaboration . ...

Еще в разделе: (Показать все результаты (>285) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1505.html
• http://xray.sai.msu.ru/~polar/sci_rev/1308.html
• http://xray.sai.msu.ru/~polar/sci_rev/0411.html

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>4) - www.issp.ac.ru/ )

Russian . Next: Events logging Up: Server configuration Previous: Additional data acquiring channels Contents Index . On the DSP Timing tab DSP and microscope's electronic main working frequencies can be configured. It is strongly recommended not to change them. Russian . Next: Events logging Up: Server configuration Previous: Additional data acquiring channels Contents Index Filonov 2005-02-04

Еще в разделе: (Показать все результаты (>13) - www.spm.genebee.msu.ru/ )

... Implementation Issues . Up: MPI-2 Terms and Conventions Next: Independence of Basic Runtime Routines Previous: Error Handling . There are a number of areas where an MPI implementation may interact with the operating environment and system. While MPI does not mandate that any services (such as signal handling) be provided, it does strongly suggest the behavior to be provided if those services are available. ... Return to MPI-2 Standard Index . ... Центры . ...

Еще в разделе: (Показать все результаты (>112) - www.parallel.ru/ )

• Interaction with Signals | PARALLEL.RU - Информационно-аналитический центр по
• Communicators | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Singleton MPI_INIT | PARALLEL.RU - Информационно-аналитический центр по

. Перейти к содержимому . Меню и виджеты . открыть | закрыть Найти: . +7 (495) 939-3038 . aislepkov physics.msu.ru . Ваш e-mail не будет опубликован. Обязательные поля помечены * . Имя * . E-mail * . Сайт . Комментарий . Можно использовать следующие HTML -теги и атрибуты: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> . Сайт работает на WordPress

Еще в разделе: (Показать все результаты (>2) - aislepkov.phys.msu.ru/ )

... Criteria of branch quality . As it was repeatedly told , phylogenetic trees consist from branches. ... I. e., those positions, which can separate sequences of the branch from other sequences in the alignment. ... Measure of branch separation . ... Here and further: A - branch of the tree, i , j - sequences of alignment . ... That's why number of conserved positions in some branch should be considered in complex with the distribution of conserved positions in the whole alignment. ...

Еще в разделе: (Показать все результаты (>40) - monkey.belozersky.msu.ru/ )

• About COGs
• About this project

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>73) - www.genebee.msu.ru/ )

• BLAST Frequently Asked Questions (FAQ)

... ManagingWebs . ... So you can't delete a topic, however you can move or rename a topic and the original information is saved in topic meta data. ... It is advisable not to rename the TWiki.Main web. ... Telnet to the TWiki installation. cd to twiki/data and rename / delete the web directory. cd to twiki/templates and rename / delete the web directory if present. cd to twiki/pub and rename / delete the web directory if present. PeterThoeny - 03 Mar 2001 . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>19190) - dualopt1.cmm.msu.ru/ )

• ( vs. 1) TWikiNetSkinColorSettings < TWiki < TWiki
• TWikiNetSkinColorSettings < TWiki < TWiki

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics , . Online Services . ... SERVICES . ... You can't use main periodic table and drop-down list of databases at this page as menu without JavaScript support. But you can choose specific table or search form for each database from the list below. ... periodic table . search form . description . Nuclear Moments . ... Nuclear Reaction Database (EXFOR) . ... description Please, select database: . ... CDFE, 2003. ...

Еще в разделе: (Показать все результаты (>13) - cdfe.sinp.msu.ru/ )

CompHEP substitutes the QCD strong coupling constant as a function of the parameter and the scale value. It is calculated in the next-to-next-to-leading order (NLLO) and depends on a number of quark flavors ( nf ) with masses less than Q (see Eq.9.5a of [ Particles&Fields ]). ... In the first case a subsequent input of number in GeV units is expected. ... For example: the input '13' will be treated as . If is defined as a constant, the corresponding value of is displayed on the screen. ...

Еще в разделе: (Показать все результаты (>283) - theory.sinp.msu.ru/ )

• Menu 3.
• Acknowledgments

... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...

Еще в разделе: (Показать все результаты (>8) - master.sai.msu.ru/ )

TES data processing aims to divide the total field into components and to cancel these, caused by geological noise. The interpretation is fulfilled firstly in 1D variant (in the frame of horizontally-layered model, with IPI-1D package), and then in 2D variant (with IE2DL package). ... This model can be corrected with the help of different transformations for better seeing position and form of the deep objects. ... Two different approaches to the interpretation of profile VES data are possible. ...

Еще в разделе: (Показать все результаты (>18) - geophys.geol.msu.ru/ )

... Introduction: In the present work the morphometric parameters for 87 large martian craters [1](with diameters from 411 up to 110 kms) have been determined: depth of a crater, the relation of depth of a crater to diameter (/D), height of a rim ґ h, with the help of profiles constructed on the basis of supervision of space vehicle MGS [2].The comparison with similar morphometric parameters of large lunar craters also is fulfiled. ... 2000) Morphological Calague Of the Craters Of Mars. ...

Еще в разделе: (Показать все результаты (>44) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Greg/Publications/ms40/81_Ushkin_Michael.pdf

... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... Ранний оптический ореол гамма-всплеска 12 декабря 2002 г. -- "младший брат" знаменитого GRB 990123 . 15.12.2002 0:21 | ... Теперь о событии среды, 11 декабря 2002 г. Гамма-всплеск GRB 021211 был зарегистрирован и локализован спутником HETE-2 . ... Как и у предшествующего, у нашего гамма-всплеска блеск мгновенного оптического ореола круто уменьшался со временем в первые 10 минут как ( для GRB 990123 за первые 14 минут), а затем стал более пологим как ( для GRB 990123 в последующие 20 часов). ...

Еще в разделе: (Показать все результаты (>425) - www.nature.web.ru/ )

• Затерянный мир острова Вида
• Затерянный мир озера Вида

... white (28 ), black (24 ), blue (21 ). , . ... Do let me go on believing that the hours drift by in a dream, that those blind blue eyes, that see nothing, not even your father's pictures, are turned inward upon some Anglo-Saxon fairyland of your own. ... What pretty white fingers you have!' And his strong brown fingers slid over her pale, slim ones, and Jelly White let them stay. , ґ ґ , . white , brown. white brown (pretty white fingers strong brown fingers), : white , brown ґ . ... red, . ...

Еще в разделе: (Показать все результаты (>150) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/files/Multimodal_directions@Montenegro_CML2008.pdf
• http://www.philol.msu.ru/~otipl/new/mscl/abstracts/fialkowska.pdf

... Extensive studies of mechanism of action of platinum drugs and platinum-induced DNA damage were held in last decades. ... So UV-spectroscopy is rarely used for quantitative kinetic studies of platination reactions, because of low accuracy of obtained data. ... We studied the reactions of sulfur-containing (S-donor) biomolecules with cisplatin and new chiral platinum complexes, and platination of DNA in the presence of competing S-donor molecules by UV- and CD-spectroscopy and PCAlike approach. ...

Еще в разделе: (Показать все результаты (>21) - www.msm.biophys.msu.ru/ )

• MSM 2007

... Program . ...

Еще в разделе: (Показать все результаты (>4) - pont2008.cmc.msu.ru/ )

... Форумы > Аспирантура > Тема . ... Форумы Список тем Новая тема . ... Аспирантура ин-т Макса Планка / ун-т Заарланда, Германия . ... http://flake.cs.uiuc.edu/~titov/ . ... http://www.mmci.uni-saarland.de/ . ... http://cs.uni-sb.de/ . ... http://www.mpi-inf.mpg.de/ . ... http://www.dfki.de . ... http://www.mpi-sws.org . ... http://www.coli.uni-saarland.de/ . ... http://www.saarbruecken.de/en/home . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>81) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD positions in logic and AI, Vancouver

... ВШБ МГУ - школе . ... Japanese Expert Takes a Stab at Moscow Traffic . ... Former Japanese Prime Minister Yukio Hatoyama faced the prospect of being stuck in Moscow rush-hour traffic perhaps for hours after his plane landed late at Domodedovo Airport. ... The presentation of a new book by Hatoyama's son on how to solve Moscow's traffic jams. The book, "Moscow: Traffic Problems of a Megalopolis," does not suggest a police escort as a solution to the city's cataclysmic traffic problems. ...

Еще в разделе: (Показать все результаты (>47) - www.mgubs.ru/ )