. RUSSIAN version . ALL PHOTOS . From a project on Vertebrate Zoology . (drawing by David Pomeranz) . * PhotoGallery "Field Practice at the White Sea" . Designed by Sergei V. Ogurtsov, 2005-2010 . E-mail: compclass7@yandex.ru .

Еще в разделе: (Показать все результаты (>7) - vertebrata.bio.msu.ru/ )

... Role of Asymptotics in Nonlinear Acoustic Propagation . ... From the mid-1970s until his untimely death in 2000, Professor David Crighton made a significant contribution to the study of nonlinear acoustic propagation using matched asymptotic expansions. ... The derivation of model equations such as the Generalised Burgers Equation will be outlined, using multiple scales methods based on the slow distortion of a disturbance due to nonlinearity and dissipation/dispersion mechanisms. ...

Еще в разделе: (Показать все результаты (>32) - acs366.phys.msu.su/ )

• Abstract

docs.kde.org . Благодарности и лицензия . ... Права на программу 1998-2000 принадлежат Регинальду Штадлбайеру (Reginald Stadlbauer) (reggie AT kde.org) . Текущее сопровождение осуществляется Лореном Монтелем (Laurent Montel) (montel AT kde.org) . ... Дэвид Фаур (David Faure) (dfaure AT kde.org) . Тошитака Фуджиока (Toshitaka Fujioka) (fujioka AT kde.org) . ... Арийя Хидайят (Ariya Hidayat) (ariya AT kde.org) . ... Этот документ распространяется на условиях GNU Free Documentation License . ...

Еще в разделе: (Показать все результаты (>27) - uneex.lorien.cs.msu.su/ )

• Глава 14. Благодарности и лицензия
• Глава 13. Авторские права и лицензирование

. пљп°яЂп» пђпЅпґпµяЂяЃпѕпЅ (Carl David Anderson) . п‘пёпѕпЕяЂп°я„пёяЏ . п’пёпєпёпїпµпґпёяЏ . пќп°яѓпєп° пё я‚пµя…пЅпёпєп° . пЎпџп±пЁ .

Еще в разделе: (Показать все результаты (>49) - nuclphys.sinp.msu.ru/ )

• пќпёп»яЊяЃ п‘пѕяЂ
• CERN-Fermilab 8

. Dubna-2004 . (prev) cimg2345 . cimg2346 . cimg2347 (next) . Photo album generated by album script from David Madison's Marginal Hacks on Thu Aug 19 14:19:50 2004 .

Еще в разделе: (Показать все результаты (>107) - xray.sai.msu.ru/ )

• Image: cimg2135
• Image: cimg2136
• Image: cimg2134

. This shell was written by David Korn of Bell labs. It is now provided as the standard shell on Unix systems. It provides all the features of the C and TC shells together with a shell programming language similar to that of the original Bourne shell. It is the most efficient shell. Consider using this as your standard interactive shell. Summary of features .

Еще в разделе: (Показать все результаты (>7) - comet.sai.msu.ru/ )

... Быстрицкий Александр . Copyright © 1996 Alexander Bystritsky. ... Producers Alexander Bystritsky and Sergey Bozin. Alexander Bystritsky . ... Монолог нильского крокодила . ... Монолог подколодной змеи . ... Монолог Деда Мороза . ... Физиологическая трилогия: Америго . ... Физиологическая трилогия: Ньютон . ... Физиологическая трилогия: Джордано . ... Монолог антисемита . ...

Еще в разделе: (Показать все результаты (>62) - geo.web.ru/ )

astro-ph/0406573 SB9: Девятый каталог орбит спектральных двойных (SB9: The Ninth Catalogue of Spectroscopic Binary Orbits) . ... astro-ph/0406252 Q0906+6930: блазар с самым большим красным смещением (Q0906+6930: The Highest-Redshift Blazar) . ... Authors: John Bahcall . ... Authors: M. W. Werner et al. astro-ph/0406629 RefSponse: Система оценки литературы для сообщества астрономов-профессионалов (RefSponse: A Literature Evaluation System for the Professional Astrophysics Community) . ...

Еще в разделе: (Показать все результаты (>192) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0902.html
• http://xray.sai.msu.ru/~polar/sci_rev/1406.html
• http://xray.sai.msu.ru/~polar/sci_rev/1506.html

Поглощение пресноводными организмами загрязнителей коллекторов: Сравнительный анализ лабораторных методов оценки степени биоаккумуляции. ... 2010. ... Методы оценки биоаккумуляции загрязнителей из седиментов коллекторных полей пресноводными беспозвоночными и рыбами требуют дальнейшей стандартизации, что сокращает дублирование и повышает надехность тестирования .В обзоре были проанализированы сходства и различия в способах протоколирования, контролируемых способах испытаний и недостающие данные. ...

Еще в разделе: (Показать все результаты (>12) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=&ref_ind=0218004195
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=1&subtheme=32&from=0&ref_ind=0207000115
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=1&subtheme=34&from=0&ref_ind=0608004264

June 29, 2015 . ... 10.00-11.25 Chair: N. Nikitin . ... Physics Prospects at Belle-II . ... Alexey Dzyuba (Petersburg NPI, Russia) . ... Davide Meloni (University of Roma Tre, Italy) . Recent developments in Neutrino Physics . ... 17.30 - 19.10 Parallel section A: Collider and neutrino physics Chair: L. Gladilin . ... Pair correlations in particle and jet production at the LHC in the parton Reggeization approach . ... V. Kuksa (Research Institute of Physics, Southern Federal University, Russia) . ...

Еще в разделе: (Показать все результаты (>42) - qfthep.sinp.msu.ru/ )

... August 28, 1998 . Hydrogen Trifid . ... Explanation: Clouds of glowing hydrogen gas mingle with dark dust lanes in the Trifid Nebula , a star forming region in the constellation Sagittarius. In this and other similar emission nebulae , energetic ultraviolet light from an embedded hot young star strips electrons from the surrounding hydrogen atoms . ... It shows those regions with substantial emission from atomic hydrogen . ... Tomorrow's picture: Star Colors . ... About APOD > . ...

Еще в разделе: (Показать все результаты (>7) - www.arcetri.astro.it/ )

... Полная версия: поделитесь,пожалуйста,самбой!) Грация-МГУ::Форум > Мультимедия > Аудио . ... Мая 29 2007, 15:32 . ... Виталий . ... Остальные 2 самбы одним архивом . ... Sep 30 2007, 12:45 . Цитата(O'Rey @ May 29 2007, 16:38) . ... Oct 4 2007, 17:28 . ... Dec 19 2007, 22:11 . ... Mar 28 2008, 13:53 . Помогите найти самбу Mora mia.. ... Цитата(Виталий @ Mar 28 2008, 15:09) . ... Apr 17 2008, 00:37 . ... Цитата(caramel @ Apr 17 2008, 01:37) . ... Цитата(Виталий @ Apr 17 2008, 02:39) . ...

Еще в разделе: (Показать все результаты (>20) - grace.msu.ru/ )

• Грация-МГУ::Форум > Помогите с джайвом...
• поделитесь,пожалуйста,самбой!) - Грация-МГУ::Форум
• Помогите с джайвом... - Грация-МГУ::Форум

... Полная версия этой страницы: Просьбы. Студенческий форум Физфака МГУ > Общий > Все обо всем > Кино, музыка, литература . Aleks . ... Вот скачайте по етой ссылке медляк очень класный из фильма Соседка. ... Поеду в Москву запишу на болванку етот фильм. ... diman . ... 2 Aleks: слушай, а у тя есть Властелин колец полная версия,не та, что в кино шла, а полная, в которой каждый фильм идет 3-3,5 часов(там больше сцен и некоторые из существующих продлены)? . ... SerAsik . 21.2.2007, 17:02 . ...

Еще в разделе: (Показать все результаты (>104) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > 13 мая 2006, 2 открытые лекции от ведущих

... The Behavior of Jewish Communities and their Losses Dr Wioletta Pawlikowska-Butterwick ( Lithuanian Catholic Academy of Sciences) Property Relations in the Jurydyka of the Vilnius Cathedral Chapter in the Sixteenth Century Discussion 5.45 pm 6.30 pm CLOSE Reception at the Polish Embassy, 47 Portland Place, London W1B 1JH Saturday 21 March: SSEES [room tbc] 9.00 am Second panel : Patrons and clients Dr Artras Vasiliauskas Vilnius ...

Еще в разделе: (Показать все результаты (>57) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal
• Книги по истории Церкви и христианской археологии
• Айрапетов Олег Рудольфович

... 6 Дек 2015 . кем editor | ... Декабрь 2015 . Ноябрь 2015 . Октябрь 2015 . Сентябрь 2015 . Май 2015 . Март 2015 . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>18) - elana.sinp.msu.ru/ )

• galleggiare o nuotare con il flusso in acqua a riva. Non cercare di combattere
• ottenere tutto.da cinghie o breve con celle di forma o lungo i siti.la burberry
• but a variety of the girls I Wallets | С Днем Победы!

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>2) - ccoe.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. Клуб выпускников МГУ (Московский Государственный Университет) . Большая проблема Канады - это дикие гуси. Они портят поля для гольфа, выщипывают траву, портят имущество, да вообще летают сотнями и делают что хотят. Дэвид Маркс (David Marcks) 20 лет занимался проблемой гусей и очень неплохо преуспел в этом. Добавить сообщение . Страница сайта http://www.moscowuniversityclub.ru . Оригинал находится по адресу http://www.moscowuniversityclub.ru/services/messages.asp?forumId=0 =5871 .

Еще в разделе: (Показать все результаты (>169) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Новости США и Канады
• Клуб выпускников МГУ: Ученые: Алкоголь вреднее экстази и ЛСД
• Клуб выпускников МГУ: Ученые нашли ключ к молодости кожи

... Pleistocene soils older than Wisconsin Age are preserved only locally in the Driftless Area of Wisconsin, USA. ... Our longest known sequence is at Oil City, Wisconsin, were a 9 m section contains 5 loesses and 3 colluvial deposits with 5 buried soils; all are Except the mid-Wisconsin Farmdale soil, all of the buried soils at Oil City have argillic horizons and are intensely weathered. ... However, few buried soils have all genetic horizons preserved. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>21) - www.fadr.msu.ru/ )

e mail: level_s@rambler.ru) , , , , , , , , conflict theory, social order, functionalism, social integration, system integration, Talcott Parsons, Ralf Dahrendorf, John Rex, David Lockwood . ... The theory of the conflict proceeds from belief that society always contains fundamental conflicts of interest and that social order is achieved by balance of power in which the interests of the stronger successfully contain and channel the demands of the weaker. ...

Еще в разделе: (Показать все результаты (>4) - vestnik.socio.msu.ru/ )