Number of cores used . ... Standard MCQDPT2 benchmark using resolvent fitting , Wall clock time and relative speedup . ... Intel Quad-core Core i7 940 2.93 GHz, Asus P6T-Deluxe Mainboard, 6x2GB (triple channel) DDR3-1333 RAM@1333 MHz, Seagate 1 TB SATA-2 ST31000340NS HDD, Windows Server 2008 Enterprise x64. ... Single-point semi-direct two-state MCQDPT2 energy (using resolvent fitting code) for medium-size system (retinal molecule, cc-pVDZ, 565 Cartesian basis functions, CAS(12,12)). ...

Еще в разделе: (Показать все результаты (>72) - classic.chem.msu.su/ )

• PC GAMESS vs. WinGamess performance comparison
• Just kidding: PC GAMESS/Firefly v. 7.1.C benchmarks on Atom-based system
• Preliminary PC GAMESS benchmarks on Quad-core Xeon (Clovertown)-based system

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... You will be asked to review the finance-related questions again after you have completed the Finance for Start-Up module. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>871) - www.fds-net.ru/ )

• [Requests] У кого есть? - Public forum of MSU united student networks
• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• Хоккей ЧМ 2008 - Public forum of MSU united student networks

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>59) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>152) - www.pereplet.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>11) - foroff.phys.msu.ru/ )

• The Faculty System of Education

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>245) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

Calcareous paleosols are widely distributed throughout the arid and semi arid regions of the world. These paleosols have been described from virtually every continent of the world, yet there is no internationally agreed upon nomenclature for the description of the horizons present within them. ... This abstract proposes the adoption of a universally agreed-upon system of horizon designation and gross morphological description of calcareous paleosols. ... Soil Science, 101, 347-360. ...

Еще в разделе: (Показать все результаты (>228) - www.fadr.msu.ru/ )

• Foundation for Agrarian Development Research - Services - Portfolio
• Abstracts

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>36) - brain.bio.msu.ru/ )

• EEG feature extraction
• Nonparametric approaches to the description of EEG piecewise stationary

... It is recommended that all lines of text be shorter than 80 characters in length. An example sequence in FASTA . ... Sequences are expected to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes, with these exceptions: lower-case letters are accepted and are mapped into upper-case; a single hyphen or dash can be used to represent a gap of indeterminate length; and in amino acid sequences, U and * are acceptable letters (see below). ...

Еще в разделе: (Показать все результаты (>138) - www.genebee.msu.ru/ )

• Picornaviruses: discovering big in small
• Genebee Predicted Annotation
• Genebee Predicted Annotation - Advanced

... Sternberg Astronomical Institute, . Moscow State Universtiy, . ... 13, Moscow, 119992, Russia . ... Graduated in Physical Departmrnt of Moscow State University, Moscow, Russia, completed by diploma in astronomy in 1975. ... From 3 January 1991 till now is Leading Researcher in Sternberg Astronomical Institute of Moscow State University, Moscow, Russia. ... Lecturer of the special course "MODERN COSMOLOGY" and "GENERAL RELATIVITY FOR ASTRONOMERS" in Sternberg Astronomical Institute. ...

Еще в разделе: (Показать все результаты (>256) - xray.sai.msu.ru/ )

• Sergei Popov's Bookmarks

Geology at Moscow State University . ... Our adjunct Professors . ... The faculty permanently extends the contacts with many overseas universities. The graduator of 1991 Artem R. Oganov who completed his PhD degree in University of London and now works as a leader of the group in ETH (Zurich) was recently nominated by the Faculty Scientific Council as an adjunct Professor. Prof. Dr. Artem R. Oganov . ... 2) Adjunct Professor, Geology Department, Moscow State University, Moscow 119899, Russia. ...

Еще в разделе: (Показать все результаты (>27) - www.geol.msu.ru/ )

• Download Yuri Shvarov's files

You are here: Foswiki > System Web > PageOptimizerPlugin (19 Mar 2012, ProjectContributor ) E dit A ttach . ... On this page: . ... http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=on (or cache): refresh the css and js cache for the current page . http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=css : refresh the css files of the current page . http://wiki.cs.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=js : refresh the js files of the current page . ...

Еще в разделе: (Показать все результаты (>1957) - wiki.cs.msu.ru/ )

• (backlinks in System Web) ContributedAddOns < System < Foswiki
• (backlinks in all Webs) ContributedAddOns < System < Foswiki
• HistoryPlugin < System < Foswiki

You are here: Foswiki > System Web > PageOptimizerPlugin (19 Mar 2012, ProjectContributor ) E dit A ttach . ... On this page: . ... http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=on (or cache): refresh the css and js cache for the current page . http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=css : refresh the css files of the current page . http://wiki.cmc.msu.ru/bin/view/System/PageOptimizerPlugin?refresh=js : refresh the js files of the current page . ...

Еще в разделе: (Показать все результаты (>5072) - wiki.cmc.msu.ru/ )

• VarSEARCH < System < Foswiki
• (backlinks in System Web) ContributedAddOns < System < Foswiki
• (backlinks in all Webs) ContributedAddOns < System < Foswiki

... 26-Sep-2011 12:35 . ... 12K . ... 14K . ... index.html . ... 22K . ...

Еще в разделе: (Показать все результаты (>1096) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/ApacheOnWin32withDomainAuthentication - UNИX
• HelpOnProcessingInstructions - UNИX
• LecturesCMC/UnixFirewalls2014/07_UsingIPTables - UNИX

CATALOGUE OF SPACE STORMS . based on the list of selected geomagnetic disturbed days with mean daily Ap>20 in 1997-2009 . ... Description of the Catalogue . NN - number of event . ... 3d Map of Solar Events - Map of the solar events on the solar surface (see Map description ) occurred from four to two days before the geomagnetic disturbed day . 3d List of Solar Events - Solar Events occurred from four to two days before the geomagnetic disturbed day (obtained from Solar Event Reports ). ...

Еще в разделе: (Показать все результаты (>22) - dbserv.sinp.msu.ru/ )

• 3d Map Description
• 1d Map Description

... It is shown that theoretical methods developed for description of hopping transport in disordered inorganic solids, such as amorphous semiconductors, can also be successfully applied to description of hopping transport in organic disordered systems, such as conjugated or molecularly doped polymers. We concentrate our discussion on percolation approach and show its universal applicability to systems with different distributions of localized state energies. ...

Еще в разделе: (Показать все результаты (>37) - scon155.phys.msu.su/ )

• Generalized pair approximation in the description of ate AC conductivity of a