... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development (Archive) . ... Java Swing, Database . ...

Еще в разделе: (Показать все результаты (>145) - www.snto-msu.net/ )

• Во всех разделах перед списком постов такая фигня: - Public forum of MSU united
• Embedded firebird database - вопрос по скорости - Public forum of MSU united
• mssql, заресторить базу из файла бэкапа - Public forum of MSU united student

.

Еще в разделе: (Показать все результаты (>6) - www.chemport.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>3) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... Форумы > Книжная барахолка > Тема . ... Форумы Список тем Новая тема . ... Продам: Книгу с курса Microsoft - Administering a Microsoft SQL Server 2000 Database . Продам книжку с официального учебного курса Microsoft . M2072 Administering a Microsoft SQL Server 2000 Database на англиском языке за 200$ c дисками за 265$ (4 диска - 2 учебных и 2 установычных для SQL базы) торг. т.926-529-14-13 . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>19) - www.mmonline.ru/ )

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>44) - comet.sai.msu.ru/ )

• Digitized Sky Engines
• Miscellaneous
• Index of manual pages: A

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>29) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ
• Структура НИВЦ

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>7) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...

Еще в разделе: (Показать все результаты (>108) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf

... Show databases показывает только br | information_schema | br | mysql љљљљљљљљљљљљљ | br | testљљљљљљљљљљљљљљ | br br љЧестно говоря, сразу после установки ошибка была другая: br ..... br Tue Jan 18 23:21:04 GMT 2011 : apel-publisher - ------ Starting the apel application ------ br Tue Jan 18 23:21:05 GMT 2011 : apel-publisher - program aborted br org.glite ... opt/glite/bin/apel-publisher -f<br> . ... gt; Wed Jan 19 23:21:08 GMT 2011: apel-publisher - ------ Starting the apel<br> . ...

Еще в разделе: (Показать все результаты (>289) - theory.sinp.msu.ru/ )

• [RU-NGI] glite-APEL installation
• Mikhail N. Smolyakov
• [RU-NGI] apel EMI3

... Goals and Tasks . ... Fellows of the Room . ... molecular-genetic study . The Room for Molecular Diagnostics Methods as an independent subdivision of the SIEE was organized in 2003. ... In 2003 a gathering of technical basis of the room was undertaken. й Meschersky, I.G., Chichkina, A.N., Shpak, O.V., Rozhnov, V.V. й A.N. Severtsov Institute of Ecology and Evolution of RAS, 2013 . ... The database will be extended as new samples analysis will done. ...

Еще в разделе: (Показать все результаты (>199) - www.sevin.ru/ )

• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:
• Институт проблем экологии и эволюции имени А.Н. Северцова (ИПЭЭ РАН): Новости:
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: II

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>195) - www.parallel.ru/ )

... head1 NAME . CGI::Session::Driver::DBI - Base class for native DBI-related CGI::Session drivers . ... require CGI::Session::Driver::DBI; @ISA = qw( CGI::Session::Driver::DBI ); . ... Should your driver require non-standard initialization you have to re-define init() method in your F<.pm> file, but make sure to set 'Handle' - object attribute to database handle (returned by DBI->connect(...)) if you wish to inherit any of the methods from CGI::Session::Driver::DBI. =head1 STORAGE . ...

Еще в разделе: (Показать все результаты (>26637) - dualopt1.cmm.msu.ru/ )

• CGISessionDriverDBIDotPm - TWiki - TWiki
• TWikiRegistration - TWiki - TWiki - (printable)
• TWikiRegistration - TWiki - TWiki

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>42) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_anon.c

Peremennye Zvezdy", . ... Min . ... OGLEII CAR-SC01 2765, 2MASS J11052668-6148368 . ... min . Comm. ... OGLEII CAR-SC01 5494, 2MASS J11051146-6144570 . ... OGLEII CAR-SC01 46493, 2MASS J11055923-6150589 . ... OGLEII CAR-SC01 69423, 2MASS J11055898-6122543 . ... OGLEII CAR-SC01 90562, 2MASS J11055545-6058470 . ... OGLEII CAR-SC01 124846, 2MASS J11062757-6113440 . ... OGLEII CAR-SC01 127687, 2MASS J11062902-6110388 . ... OGLEII CAR-SC02 17, 2MASS J11071601-6152001 . ... MinII = 16.83. ...

Еще в разделе: (Показать все результаты (>1523) - www.astronet.ru/ )

• XWare Team

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Help www.sciencedirect.com www.sciencedirect.com R www.sciencedirect.com , ScienceDirect. , (licensed user). ... R PAGE 1 OF 9 www.sciencedirect.com Quick Search, Journals, Books, Reference Works and Abstract Databases Quick Search ( ), Journals (), Reference Works ( ), Books ( ) Abstract Databases ( ). Quick Search ( ) - , . ... ProCite, EndNote Reference Manager). 3a 3a R PAGE 8 OF 9 www.sciencedirect.com 1 Alerts ( ) , , : I Search Alerts ( ); I Journals Issue Alerts ( ); I Citation Alerts ( ). ...

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

Correlation Engine Portotype V.Pose, JINR Dubna B.Panzer-Steindel, CERN IT Overview The Correlation Engine Prototype was developed during a 3-month work in CERN IT Division financed by the CERN-Intas project. The CERN monitoring prototype, part of the fabric management work package (WP4) of the DataGrid project, gathers monitoring data from farm nodes in CERN into a central monitoring database. ... Two engines are implemented - ayt and procpu. ... connects to such a node using the ayt engine . ...

Еще в разделе: (Показать все результаты (>18) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

59. LangueDOC :: Courses

60. Lev V. Dudko Home Page