... Computer software has been developed for crystal chemistry analysis of arrangement of molecules in organic crystals on the basis of concepts worked out in the studies conducted by P.M.Zorky et al. ... The standard crystal chemistry analysis includes: . ... Constructing various graphic representations of the crystal structure and of its fragments, which clearly demonstrate arrangement of molecules, in particular, constructing representations of the most close molecule-molecule contacts. ...

Еще в разделе: (Показать все результаты (>705) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 43, No. 6, P. 381 (2002)
• Exciplexes on INTERNET
• Moscow University Chemistry Bulletin Vol. 51, No. 5, P. 393 (2010)

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>58) - erg.biophys.msu.ru/ )

• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• pymol ERG Research Group: Лаборатория теоретической биофизики
• OPLS ERG Research Group: Лаборатория теоретической биофизики

Raw observational data of natural satellites . ... See the " Rules for natural satellites observation raw data CONTENT file" . ... See the parameters of the new satellites of Jupiter , Saturn , Uranus , Neptune . See the sources of data of the new satellites of Jupiter , Saturn , Uranus , Neptune . ... Inner satellites of Jupiter . ... Inner satellites of Saturn . Main satellites of Saturn . ... Inner satellites of Uranus . Main satellites of Uranus . ... Inner satellites of Neptune . ...

Еще в разделе: (Показать все результаты (>180) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure
• Data bases of Natural Satellites. Documentation. Sources
• Description of Data

Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>167) - sp.cs.msu.ru/ )

• Logic and Databases
• C-DVM language description
• Fortran DVM language description

... The Linnaean Collection of the Herbarium of Moscow State University: digital images, comments, historical review. ... Eight bonus high quality images of 700 ppi resolution. ...

Еще в разделе: (Показать все результаты (>6429) - herba.msu.ru/ )

• Systema Naturae
• North Dakota Ethnobotany Database
• Heterogeneity in Northern Russian Alders

Each row in the Particles Table describes a particle - anti-particle pair. ... 2*Spin for a doubled particle spin: 0 for scalar, 1 for spinor and 2 for vector particles. ... In this case the anti-particle "A+" is transformed by conjugated representation. ... Aux for an auxiliary field which allows to modify particle propagators. ... spin 0 case: . ... Zero mass vector particle must be marked as a gauge one using the Aux field (see below). ... is permitted for vector ( 2*spin=2 ) particle. ...

Еще в разделе: (Показать все результаты (>1091) - theory.sinp.msu.ru/ )

• spamassassin - extensible email filter used to identify spam
• Interaction of the Higgs doublet with fermions and generation of fermion masses
• The RU-NGI First quarter 2013 Archive by thread

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kireeva N. , Baskin I.I. , Gaspar H.A. , Horvath D. , Marcou G. , Varnek A. в журнале Molecular informatics , издательство Wiley-VCH Verlag (Weinheim, Germany, Germany) , том 31, ? ... Varnek Alexandre , Baskin Igor . ... Baskin Igor I. , Kireeva Natalia , Varnek Alexandre . ...

Еще в разделе: (Показать все результаты (>1945) - istina.msu.ru/ )

• Marcou Gilles - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Gaspar H.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Advances in database technology : proceedings. International Conference on

GENERATION OF PARTICLES IN VACUUM IN PRESENCE OF STRONG ELECTROMAGNETIC FIELDS S. A. SMOLYA NSKY ? ... The process of particle-antiparticle pairs generation in the presence of strong electromagnetic fields is described, using the simplest models of physical vacuum. ... Further we discuss the latest works on kinetic description of the process of particles generation in vacuum in the presence of strong non-stationary fields. ­ . 2001 =c m c +p . ... 2mc2. - - , 2mc2 2 (-) (-) . ... kin , Vmax . ...

Еще в разделе: (Показать все результаты (>97) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/nekrasov.pdf

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

The QIconSet class provides a set of icons (normal, disabled, various sizes) for e.g. buttons. ... QIconSet  ( const QPixmap &, Size = Automatic )  . QIconSet  ( const QIconSet & )  . ... void  setPixmap  ( const QPixmap &, Size, Mode = Normal )  . ... Sets this icon set to display pn in size s/mode m, and perhaps to use pm for deriving some other varieties. Sets this icon set to load fileName as a pixmap and display it in size s/mode m, and perhaps to use pm for deriving some other varieties. ...

Еще в разделе: (Показать все результаты (>456) - rtm-cs.sinp.msu.ru/ )

• sendmail address rewriting mini-HOWTO
• Example
• Qt Toolkit - QButtonGroup Class

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>14) - mailybaev.imec.msu.ru/ )

... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>30) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

... mpireconfig . Constucts makefiles from template files The mpireconfig command takes a template file and creates a file that may be given to the make command by replacing variable with values appropriate for a particular MPICH configuration. mpireconfig filename . filename . Name of file to be generated. The file filename.in must exist. mpicc, mpif77, mpif90, mpiCC . Location: /home/MPI/mansrc/commands . ... Центры . ...

Еще в разделе: (Показать все результаты (>506) - www.parallel.ru/ )

• mpiCC | PARALLEL.RU - Информационно-аналитический центр по параллельным
• mpif90 | PARALLEL.RU - Информационно-аналитический центр по параллельным
• mpif77 | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>148) - wasp.phys.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>75) - electr003.chem.msu.ru/ )

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>92) - hist.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>69) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research
• Intelligent Systems :: Research :: Computer Solver
• Intelligent Systems :: Research :: :: Demos