... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>14) - foroff.phys.msu.ru/ )

• The Faculty System of Education

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>26) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>117) - nuclphys.sinp.msu.ru/ )

• Альфа-распад (измерения)

... Reduction of detailed schemes for chemical transformations of formaldehyde and hydrogen oxidation reactions based on a sensitivity analysis of a mathematical model" . ... The results of simulation are compared in the case of using a number of reduced and detailed schemes for formaldehyde and hydrogen oxidation reactions. Keywords: sensitivity analysis, mathematical model of reaction, formaldehyde oxidation reaction, hydrogen oxidation reaction, reduction of chemical reaction mechanisms. ...

Еще в разделе: (Показать все результаты (>194) - num-meth.srcc.msu.ru/ )

• "Calculation of optimal coefficients for quadrature formulas by the complete
• "Application of the Quickhull algorithm's principles to the double description
• "TreeDL: a language for description of graph structures and operations on them"

V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial hypermagnetic helicity evolution, J. Cosmology and Astroparticle Phys., 06, 008, 2012. The hypermagnetic helicity density at the electroweak phase transition (EWPT) exceeds many orders of magnitude the galactic magnetic helicity density. ... This should be taken into account in scenarios of galactic magnetic field evolution with a cosmological seed. ...

Еще в разделе: (Показать все результаты (>53) - srcc.msu.ru/ )

• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial
• Kazakevich, Olga. Documentation and description of the Northern Selkup local
• Rafaeva, Anna. Description of Propp's Roles in Russian Magic Folktales

Number of cores used . ... Standard MCQDPT2 benchmark using resolvent fitting , Wall clock time and relative speedup . ... Intel Quad-core Core i7 940 2.93 GHz, Asus P6T-Deluxe Mainboard, 6x2GB (triple channel) DDR3-1333 RAM@1333 MHz, Seagate 1 TB SATA-2 ST31000340NS HDD, Windows Server 2008 Enterprise x64. ... Single-point semi-direct two-state MCQDPT2 energy (using resolvent fitting code) for medium-size system (retinal molecule, cc-pVDZ, 565 Cartesian basis functions, CAS(12,12)). ...

Еще в разделе: (Показать все результаты (>81) - classic.chem.msu.su/ )

• PC GAMESS vs. WinGamess performance comparison
• PC GAMESS/Firefly DOCUMENTATION - Quantum Fast Multipole Method
• Just kidding: PC GAMESS/Firefly v. 7.1.C benchmarks on Atom-based system

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>113) - www.psy.msu.ru/ )

The Isaac Newton Institute (Instituto Isaac Newton) for astronomical research (INI) was founded in 1978 by Gonzalo Alcaino. The main office is located in the eastern outskirts of Santiago (Chile). ... The Moscow branch was the first one established outside Chile. ... Besides the above named branches, the Chilean staff of the Isaac Newton Institute is involved in collaboration with astronomers of the Observatory of Rome in several research projects using data secured from telescopes in Chile. ...

Еще в разделе: (Показать все результаты (>353) - xray.sai.msu.ru/ )

• Sergei Popov's Bookmarks
• Seminars

... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>77) - www.enzyme.chem.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Nhunt: program for nucleic acid sequence similarity search

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>63) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Magazine :: Web archive :: Volume 17, Issue 1-4, 2013

CATALOGUE OF SPACE STORMS . based on the list of selected geomagnetic disturbed days with mean daily Ap>20 in 1997-2009 . ... Description of the Catalogue . NN - number of event . ... 3d Map of Solar Events - Map of the solar events on the solar surface (see Map description ) occurred from four to two days before the geomagnetic disturbed day . 3d List of Solar Events - Solar Events occurred from four to two days before the geomagnetic disturbed day (obtained from Solar Event Reports ). ...

Еще в разделе: (Показать все результаты (>22) - dbserv.sinp.msu.ru/ )

• 3d Map Description
• 1d Map Description

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>1049) - www.fds-net.ru/ )

• [Requests] У кого есть? - Public forum of MSU united student networks
• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student
• Новинки программного обеспечения - Public forum of MSU united student networks

... The Russian Federation Presidential Commission on the modernization and technological development of Russian economy Project "Formation of Highly Qualified Supercomputing Technology and Dedicated Software specialist training system" is now complete. ... Lomonosov Moscow State University, . ... The nationwide system of Research and Education Centers for Supercomputing Technologies (REC SCT), incorporating all Russian Federal Districts, formed the basis for the successful implementation of the project...

Еще в разделе: (Показать все результаты (>35) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• MSU's HPC HISTORY | Moscow University Supercomputing Center

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>153) - www.pereplet.ru/ )

• Super Ratio

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>17) - bioinf.fbb.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>43) - brain.bio.msu.ru/ )

• EEG feature extraction
• Nonparametric approaches to the description of EEG piecewise stationary

Almost homogeneous toric varieties Ivan Arzhantsev Moscow State University based on a joint work with JЁ urgen Hausen "On emb eddings of homogeneous spaces with small b oundary" 1 1. ... r } } 0 0 a collection of cones (V ) is connected if 1, 2 : 1 2 = is maximal if it is connected and is not a prop er sub collection of a connected collection v = vi + · · · + vip V , vj = 0 (v ) = C one(i1 , . ... r ) = (T )Q and = 0 8 a toric variety X is 2-complete if X X with codimX (X \ X ) implies X = X . ...

Еще в разделе: (Показать все результаты (>252) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf