. Buildings . Bolshoi Theatre . State Bank . The Imperial University . Manezh and the Trinity Gate

Еще в разделе: (Показать все результаты (>54) - selena.sai.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Market >> Market (Archive) . ... Cистемник! Building for You . ... Building for You [ re: ismolnik ] . ...

Еще в разделе: (Показать все результаты (>2638) - www.snto-msu.net/ )

• Microsoft Windows 7 pre - beta build 6956 - Public forum of MSU united student
• Microsoft Windows 7 Build 6519 M1 DVD-MSBP - Public forum of MSU united student
• кто шарит в C++builder[CLOSE] - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Market >> Market (Archive) . ... Cистемник! Building for You . ... Building for You [ re: ismolnik ] . ...

Еще в разделе: (Показать все результаты (>3599) - www.fds-net.ru/ )

• testing Test Complete - Public forum of MSU united student networks
• Microsoft Windows 7 pre - beta build 6956 - Public forum of MSU united student
• Microsoft Windows 7 Build 6519 M1 DVD-MSBP - Public forum of MSU united student

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>113) - www.mce.biophys.msu.ru/ )

• Books : Программирование в С++ Builder 6 и 2006 + приложение
• Books : Язык С++ в С++ Builder
• Books : Make, Build, Autotools. Управление программными проектами

.

Еще в разделе: (Показать все результаты (>18) - www.chemport.ru/ )

The analysis of the asymptotic behavior of Ornstein - Zernike equation shows that the phase transitions on binodal cannot exist in the standard theory, which accounts for the analytical solutions only. To obtain the transitions it is necessary to build the nonlinear theory. ... It allows one to describe the critical phenomena in complete agreement with the experimental data and with the scaling theory, as well as to explain the nature of the liquid - vapor phase transitions. ...

Еще в разделе: (Показать все результаты (>86) - polly.phys.msu.ru/ )

• About me
• International Workshop "Theory and Computer Simulation of Polymers: New
• Timetable - Chair of Polymer and Crystal Physics

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>99) - nuclphys.sinp.msu.ru/ )

• Shkhelda-tau summit Leader of a party consisting of builders of underground
• Альфа-распад (измерения)

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>7) - lhe.sinp.msu.ru/ )

This document explains how to install, configure and run Apache 1.3 under Novell NetWare 5.x and above. ... Apache 1.3 is designed to run on NetWare 5.x and above and is installed by default on all NetWare 6 servers. ... You will need to compile apache and copy the files over to the server manually. ... Follow these steps to install Apache on NetWare from the binary download (assuming you will install to sys:/apache): . ... Copy the MIME.TYPES and magic files to SYS:/APACHE/CONF directory . ...

Еще в разделе: (Показать все результаты (>91) - neptun.sai.msu.ru/ )

• Compiling and Installing Apache
• Definitions of terms used to describe Apache directives
• Apache 1.3 Dynamic Shared Object (DSO) support

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>6977) - mouse.belozersky.msu.ru/ )

• NPG-explorer
• Geometrical core

Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>11) - suny.msu.ru/ )

... ON LANGUAGE . ... TOWARD THE LANGUAGE OF HAPPINESS . ...

Еще в разделе: (Показать все результаты (>146) - www.psy.msu.ru/ )

Russian . ... Projects . ... FADR conducts activities in (the) two general fields: information support for agribusiness and farmers, and the development and implementation of the new educational programms. ... The main focus of the Foundation for Agrarian Development Research (FADR) is the information support to agricultural producers. ... In 2000, the Canadian Agency for International Development regarded the Russian Rural Information Network project the best agricultural project. ...

Еще в разделе: (Показать все результаты (>148) - www.fadr.msu.ru/ )

• Foundation for Agrarian Development Research - Grants management
• Foundation for Agrarian Development Research - Web-development
• "EcoPhoto" - Order photo - CD

... Nonlinear Acoustic Diagnostics of Defects and Damages of Buildings and Engineering Constructions . ... A large experience was accumulated during last decade in the application of nonlinear methods of acoustic diagnostics of bridges, tunnels, thermal power stations, new high-rise buildings and historically valuable architectural objects. ... This contact problem plays the principal role for the new building up when the new house is surrounded by tumbledown houses, and the subway is laid under it. ...

Еще в разделе: (Показать все результаты (>76) - acs366.phys.msu.su/ )

• AUTHOR : Ershova N
• AUTHOR : Robsman V

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>13) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

... Home > Department of Functional Analysis and its Applications . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. Functional Analysis by Prof. Moiseev, 32 hours, 6th semester. ... Boundary Value and Spectral Problems by Prof. Moiseev. ...

Еще в разделе: (Показать все результаты (>154) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications | CMC MSU
• Laboratory of Ternary Informatics
• Laboratory of Programming Technologies

... Laboratory of Mathematical Methods of Image Processing . ... Congratulations to our alumni (bachelors) . ... Grid warping for image sharpening using one-dimensional approach (Andrey Krylov, Alexandra Nasonova, Andrey Nasonov) . ... Grid warping in total variation image enhancement methods (ICIP 2014, Andrey Nasonov, Andrey Krylov) . Image warping in dermatological image hair removal (ICIAR 2014, Alexandra Nasonova, Andrey Nasonov, Andrey Krylov, Ivan Pechenko, Alexey Umnov, Natalia Makhneva) . ...

Еще в разделе: (Показать все результаты (>103) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing
• About Laboratory | Laboratory of Mathematical Methods of Image Processing

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

... Section staff . History of the Section . ... Zoological Museum was founded in 1791 as the Cabinet of Natural History at the Moscow Imperial University. ... Subsequently, zoological collections were divided into exhibition, teaching, and research parts in the 1860-ies, and the museum began to function as 'public' since 1866. ... The entire exhibition became updated, the collection depositories were significantly enlarged, research part of the museum became divided into several sections. ...

Еще в разделе: (Показать все результаты (>771) - zmmu.msu.ru/ )

• Invertebrates
• Global fossil bat records - abstract
• Order Chiroptera

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>155) - www.pereplet.ru/ )