... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... The GW from coalescing compact binaries composed of NS and BH are the best understood of all astrophysical GW sources. A conservative lower limit to the event rate of galactic binary neutron star coalescence of about 1 per 100000 year follows from double pulsar   statistics studies (Narayan et al. ... In Figure  47 we show the rates of coalescence of binary WD and NS in a model elliptical galaxy   consisting of stars, depending on time elapsed since the (assumed instantaneous) star formation. ...

Еще в разделе: (Показать все результаты (>247) - xray.sai.msu.ru/ )

• Binary NS Merging Rate Estimates
• References
• The Model

The Status Module is only available in Apache 1.1 and later. The Status module allows a server administrator to find out how well their server is performing. ... The number of children serving requests . ... The status of each child, the number of requests that child has performed and the total number of bytes served by the child (*) . ... Module: mod_status . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>273) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - qptrdict.h include file
• Qt Toolkit - qcache.h include file
• Qt Toolkit - qintdict.h include file

Dynamic Shack-Hartmann System RAPID V. G. Orlov, V. V. Voitsekhovich Instituto de AstronomМa, UNAM, MИxico CONACYT project E9507-1020P UNAM PAPIIT IN104910 Telescopes OAN OAN- SPM 2.1m telescope 1.5m telescope 0.84m telescope 2.1m telescope OAN-Tonanzintla 1m telescope Astronomical site SPM Observing statistics 1982-2002 (Tapia+ 2007 ) Photometric nights : 64.1% Spectroscopic ... Rapid - Dynamic Shack-Hartmann All modern telescopes demand installation of adaptive system. ...

Еще в разделе: (Показать все результаты (>13) - site2010.sai.msu.ru/ )

... Invariants for Generalised Burgers Equations . ... Recently, one of the authors (NHI) adopted the infinitesimal method for calculating invariants of families of differential equations using the equivalence groups. ... Here, we use the above method for calculating invariants of the family of generalised Burgers equations which has applications in acoustic phenomena and furthermore has been used to model turbulence and certain steady state viscous flows. ...

Еще в разделе: (Показать все результаты (>122) - acs366.phys.msu.su/ )

• AUTHOR : Ibragimov N
• AUTHOR : Sophocleous C

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>10) - antares.sinp.msu.ru/ )

... GeneBee . ... Courses in Bioinformatics . ... What is GCG? ... Usage of GCG Package on GeneBee Server . ... What is WhatIf? ... Computer Class . ... Due to colaborate work of many laboratories the total length of published nucleotide sequences is now . ... GCG vs. ... Usage of GCG Package on GeneBee server . ... Computer class . ... Computer class is used for bioinformatic courses and for scientific semenars. ... Everyone who need a consultation for GeneBee service, GCG or WhatIf package is welcomed...

Еще в разделе: (Показать все результаты (>101) - www.genebee.msu.ru/ )

• Genebee Predicted Annotation
• Genebee Predicted Annotation - Advanced
• GeneBee BLAST 2.2.8 Services Help

This module provides information on server activity and performance. ... Compatibility: Available in Apache 1.1 and later. ... ExtendedStatus To enable status reports only for browsers from the foo.com domain add this code to your httpd.conf configuration file <Location /server-status> SetHandler server-status Order Deny,Allow Deny from all Allow from .foo.com </Location> . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>47) - neptun.sai.msu.ru/ )

• Manual Page: logresolve - Apache HTTP Server

... Наши профессиональные области: прикладная статистика, анализ сигналов и контроль процессов биологической и физической природы, история, философия, религия и др. ... Прочие же антропометрические показатели автора крайне заурядны и не представляют абсолютно никакого исследовательского интереса. см. также: Внатуре Арийская генеалогия Мастера . ... CONAN-t - Integrated Computer Series for Frequency Analysis, Control and Automation over Processes in Industrial and Technical Applications . ... Download . ...

Еще в разделе: (Показать все результаты (>8) - www.protein.bio.msu.ru/ )

... Форумы > Аспирантура > Тема . ... PhD position in the University of Florida . PhD position is available in the department of Industrial and Systems Engineering, University of Florida. ... Risk Management and Financial Engineering Lab website: http://www.ise.ufl.edu/rmfe/ . ... Statistical estimation in terms of factor models can be tuned to risk preferences in order to achieve better performance when applied to portfolio optimization. ... University of Florida, November 2011. ...

Еще в разделе: (Показать все результаты (>75) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантская вакансия: байесовский анализ в
• MMOnline | Форумы | Разное | предложение о работе

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>30) - brain.bio.msu.ru/ )

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>6) - suny.msu.ru/ )

LABORATORY . ... It was founded by two young Candidates of Philology who had just got their scientific degrees Boris Andreevich Uspensky and Vladislav Mitrofanovich Andruschenko as interdepartmental laboratory based on three departments: the English Language Department of the Philological Faculty, Foreign Languages Department for the Humanities and Arabic Department of the Institute for Asia and Africa. ... Vladislav Mitrofanovich Andruschenko was at the Head of the Laboratory from 1964 till 1983. ...

Еще в разделе: (Показать все результаты (>3) - lcl.srcc.msu.ru/ )

... Instrument panel contains (from left to right): sample fast approach/retract buttons, stepper power supply on/off button (if this feature is enabled in program configuration), show statistics button, sound on/off button, volume control buttons, toggle to small window button (in the small window regime only instrument panel and oscilloscope is shown, window title is reduced, window is always on top of other windows), button that opens About window. ...

Еще в разделе: (Показать все результаты (>50) - www.spm.genebee.msu.ru/ )

. WWW Statistic . Postgraduate student of 1 year of Institute of Astronomy of Russian Academy os Sciences . Young reseacher of Astronomical Division . ( Sternberg Astronomical Institute ) . Faculty of Physics . Moscow State University . Observer of student's astronomical observatory . Programmer of the NEXT Company .

Еще в разделе: (Показать все результаты (>75) - comet.sai.msu.ru/ )

• Courses
• What is the history of this file?
• WWW and Web Tools

... Statistics in Medicine [Stat Med] . Common information . ... no information] . ... 0277-6715 . ... since 1982-01-01 till today . ... subscription - $3270,single article - $32 . ... medicine . ... http://www3.interscience.wiley.com/cg.. ... 1982-01-01 . today . ...

Еще в разделе: (Показать все результаты (>11) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog

... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>58) - sp.cs.msu.ru/ )

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

... Геология >> Информационные технологии | ... Программа ищет и показывает закономерности в организации линейных элементов дистанционных данных. ... С не меньшим основанием можно анализировать рисунок хребтов и долин в цифровых моделях рельефа (ЦМР). ... И, наконец, LESSA позволяет анализировать бинарные схемы полученные любым другим путем, например, схемы ручного дешифрирования линеаментов, схемы гидросети и т.д. ( подробности на сайте http://www.lineament.ru ) . ...

Еще в разделе: (Показать все результаты (>133) - geo.web.ru/ )

• COMPASS
• миндат.орг

... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>45) - old.philol.msu.ru/ )

• MSU - Laboratory for General and Computational Lexicology and Lexicography