... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Nuclear Instruments and Methods in Physics Research B 206 (2003) 902­906 www.elsevier.com/locate/nimb Generation of the large current cluster ion beam T. Seki a c a,b,* , J. Matsuo a, G.H. Takaoka a, I. Yamada b,c Ion Beam Engineering Experimental Laboratory, Kyoto University, Sakyo, Kyoto 606-8501, Japan b Collaborative Research Center for Cluster Ion ... The intensity of neutral cluster beam increased with source gas pressure. ... The beam current increased with source gas pressure. ...

Еще в разделе: (Показать все результаты (>38) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_455_1maclasterionSource.pdf

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

• Symposia
• Invited speakers

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>17) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf
• http://dfgm.math.msu.su/files/papers-sym/remark%20on%20nonsymmetric%20compact%20surfaces.pdf

... The data center is designed to meet the significant growth in Singapore, generated by demand from the company existing customer base of carriers, content providers and enterprises, as well as increasing interest from companies throughout South Asia and financial trading companies. ... The company is also expanding in other parts of the Asia Pacific region, having recently opened a new SY2 center in Sydney. ... north face outlet uk . michael kors outlet uk . ...

Еще в разделе: (Показать все результаты (>16) - elana.sinp.msu.ru/ )

• michael kors outlet uk which is accessible via the Internet as a Web server.

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>29) - hbar.phys.msu.ru/ )

Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

... Ph.D., Interregional Public Organization Women in Science and Education ; Faculty of Biology, Lomonosov Moscow State University. ... Social cohesion and unity of the Russian state provides multilateral cooperation and dialogue. The development of the dialogue encourages wide public discussion of a new paradigm of education, the generation of the new ideas to find solutions that promote moral consolidation of the Russian society. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>10) - ee-journal.spa.msu.ru/ )