NET .., .. . ... JScript.NET ( VBScript.NET). ... int C/C++, .NET , , ++ ++ , ++. ... public ScriptEngine( string [] assemblyReferences) { GlobalScope gs = VsaEngine.CreateEngineAndGetGlobalScope( false, assemblyReferences); VsaEngine engine = gs.engine; GlobalScope newGS = new GlobalScope(gs,engine); engine.PushScriptObject(newGS); m_GlobalScope = newGS; } // public object Eval( string scriptText) { // object result = null ; return sScript; } // // static void CollectNamespaces( Assembly ...

Еще в разделе: (Показать все результаты (>12) - imaging.cs.msu.ru/ )

... Declaring new groups . ... Index type is defined by two keywords 1 : group name and representation name . Thus, color triplet index type color c3 has group name color and representation name c3 . ... So, three index types can be used: color c3, color c3b, color c8 . ... Array, i.e. the object with explicit components, can also have the user-defined type of index. ... If itype is omitted LanHEP uses default group name wild and index type wild N , where N is a number of components in the array. ...

Еще в разделе: (Показать все результаты (>990) - theory.sinp.msu.ru/ )

• rfbr:rest:jobschema [THEP]
• [RU-NGI] Monitoring of our CreamCe
• [RU-NGI] glite-APEL installation

... Главная -> Фильмы -> The Object of My Affection . ... Фильмы . ... The Object of My Affection . ... Lauren Pratt . ... Lauren Chen . ... John Pankow . ... Edward James Hyland . ... John Roland . ... Sarah Knowlton . ... Sarah Hyland . ... Джордж и Нина - прекрасная пара. ... Первая: Нина беременна и хочет, чтобы Джордж стал отцом ее ребенка. И вторая: Джордж - голубой. ...

Еще в разделе: (Показать все результаты (>456) - kinfo.ru/ )

• Love Object - Фильмы - Kinfo.ru
• The Objective - Фильмы - Kinfo.ru
• The Object of Beauty - Фильмы - Kinfo.ru

... The script is intended to be used from PyMol molecular visualization system and allows one to generate &QM_KIND, &LINK and &CELL parts of CP2K input easily. Given a molecular object name and QM part selection name (which can be defined using either approach available in PyMol) it generates output file with corresponding input groups. ... Save it to some file . ... Нет комментариев " Visual approach to construction of &QMMM section of CP2K input file " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>60) - erg.biophys.msu.ru/ )

• cp2k ERG Research Group: Лаборатория теоретической биофизики
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• PyMol script for scanning potential energy surfaces ERG Research Group:

... Create New Order" -- . ... 1 2, : # OrderDetail (OrderMgr) # OrderMgr (Order) # OrderMgr (TransactionMgr) # TransactionMgr Order # TransactionMgr (OrderItem) # Order OrderItem 4. ... Boundaries: # OrderOptions # OrderOptions # OrderDetail # OrderDetail Boundaries: # OrderOptions OrderOptions # OrderDetail OrderDetail # OrderOptions OrderDetail Control: # OrderMgr # OrderMgr # TransactionMgr # TransactionMgr Control: # OrderMgr OrderMgr # TransactionMgr TransactionMgr # OrderMgr TransactionMgr 1. ...

Еще в разделе: (Показать все результаты (>162) - sp.cs.msu.ru/ )

• http://sp.cs.msu.ru/courses/ooap/umlpracticum2004.pdf
• Lib-DVM. Interface description
• BlueBookImplementationTOC

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>166) - www.genebee.msu.ru/ )

• GeneBee service

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Approximate price in Conference bookstall 180 roubles. You need to submit Conference application first to order books to Conference bookstall. ...

Еще в разделе: (Показать все результаты (>205) - www.mce.biophys.msu.ru/ )

• Introduction problems of object-oriented programming in school course

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>60) - www.msm.biophys.msu.ru/ )

... If you have been using a tool such as the line drawing tool which does not allow you to select other objects, you can use this menu item to return to the normal selection cursor. ... This puts a colored copy of either text or a drawn object behind it. ... Your options are color , (which lets you set either a plain color or one of many gradients) Clipart (which gives a dialog box to let you find your clipart on your hard drive) or picture , which again gives a dialog box to find the picture you want....

Еще в разделе: (Показать все результаты (>538) - uneex.lorien.cs.msu.su/ )

• mod_dav - Apache HTTP Server
• Index of /static/AltDocs_informatika2/Book2/ch_11_ruby/01_object
• Index of /static/AltDocs_informatika1/Book1/3_graphics/5_xfig/00_object

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>13) - mouse.belozersky.msu.ru/ )

• MTPro

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>136) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура в Порту, Португалия
• MMOnline | Форумы | Разное | Куча Е-Буков
• MMOnline | Новости | Эволюция Программиста

CRIMEAN FIELD GEOLOGICAL CAMP, FIRST YEAR (1st CRIMEAN) . First Crimean Field Camp is organized for the MSU Geological Faculty first year students. ... Professors and researchers from Dynamic Geology Department of Geological Faculty and Russian Academy of Science Institute of Geology are leadind the students. ... SHORT HISTORY OF THE 1st CRIMEAN . ... The main goal of the field camp is to show students how geological processes work now and what we can learn about them in the past. ...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>1292) - istina.msu.ru/ )

• Mingaliev M.G. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Race and Class - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Calphad: Computer Coupling of Phase Diagrams and Thermochemistry - журнал |

. Prague, August 16, 2006 . Present classification : Suggested: . X, XB, XF, XI, XJ, XND, AM (move to cataclysmics), X, X N, XNB (approximately corresponds to XNG, a B star orbiting a compact object), Xlm (low mass), Xhm (high mass), Xmq (microquasars). In this class, advice from experts is especially needed . X-RAY VARIABLES

Еще в разделе: (Показать все результаты (>95) - sai.msu.ru/ )

• Второй пробный вариант классификации (11 мая 2006 г
• General Catalogue of Variable Stars: classification.
• General Catalogue of Variable Stars: Vols I-III (the new electronic version).

... Современная видовая принадлежность: Bombylius maculithorax . Первоначальное написание названия: Bombylius maculithorax Paramonov, 1926, . ... Первоописание: Paramonow S.J. 1926. Beitr?qe zur Monographie der Gattung Bormbylius L. (Fam. Bombyliidae, Diptera) // Acad?mie des Sciences de l'Ukra?ne, Memoires de la Classe des Seiences Physiques et Math?matiques. ... P. 77-184. ...

Еще в разделе: (Показать все результаты (>5144) - zmmu.msu.ru/ )

• Invertebrate Zoology
• Invertebrates

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>47) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• MSU-LGCLL:: A.A.Polikarpov, V.J.Kurlov - Stylistics, Semantics, Grammar: an

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>1050) - monkey.belozersky.msu.ru/ )

• Molecular biology databases
• PDB entries containing domains of the family "tRNA synthetases class I (C)
• PDB entries containing domains of the family "tRNA synthetases class I (R)"

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Pipe Line Filtering Dmitry V. Yurin Moscow State University, Faculty of Computational Mathematics and Cybernetics, Lab. of Mathematical Methods of Image Processing. yurin_d@inbox.ru Abstract A unified template C++ library is proposed for image filtering by local environment. ... It makes easy to combine filters and transfer output of filters to input of others. ... Otherwise, each filter one time should process input and output lines with the same relative numbers in the images. ...

Еще в разделе: (Показать все результаты (>167) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_kravtsov.scripting.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• Ringing analysis - database | Laboratory of Mathematical Methods of Image

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )