... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>14) - ani.cmc.msu.ru/ )

BILLIARD WALK ­ NEW SAMPLING ALGORITHM Gryazina E. 1, Polyak B. 1 Institute for Control Sciences RAS, 65, Profsoyuznaya st., Moscow, 117997, Russia, +7 (495) 334 7641, gryazina@gmail.com Generating points uniformly distributed in an arbitrary bounded (measurable) region QR (sampling) finds applications in many computational problems. ... The other sampling procedures use modern versions of Monte Carlo technique, based on Markov Chain Monte Carlo (MCMC) approach [1]. ... Algorithm of Billiard Walk 1. ...

Еще в разделе: (Показать все результаты (>297) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc15665/doc.pdf
• http://www.mce.biophys.msu.ru/archive/doc97482/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc62814/eng.pdf

... Here is a brief outline of the current theory of the events in the early history of the solar system: . A cloud of interstellar gas and/or dust (the "solar nebula") is disturbed and collapses under its own gravity. ... The gas cools off enough for the metal, rock and (far enough from the forming star) ice to condense out into tiny particles. (i.e. some of the gas turns back into dust). ... Once the larger of these particles get big enough to have a nontrivial gravity, their growth accelerates. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

... Let the control system be given by the equation dx = X (x, u) = X, u U, dt where X is a vector field on the configuration space M , x M , u is the control parameter, U is the set of admissible values of u. With the vector field X we canonically associate a scalar-valued fiberwise linear function HX on the cotangent bundle T M , HX ( , u) = , X ( , u) , T M , u U, where : T M - M is the canonical pro jection. ...

Еще в разделе: (Показать все результаты (>43) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/VasilievaButuzovNefedov.pdf
• Program Международная конференция Дифференциальные уравнения и топология ,

Home People Activities Research Publications . ... Containers for image storage in memory, reading and writing of image files, Pipeline filtering library, D.Yurin "On the Images Pipe Line Filtering, PDF , color spaces, fast convolutions, image registration algorithms, edge curvature estimation via differential invariants (under development) , Bresenham algorithms, some numerical algorithms etc. ... Download help on project (CHM) , generated via doxygen (see How to document program's code ) . ...

Еще в разделе: (Показать все результаты (>17) - imaging.cs.msu.ru/ )

... 2015 . ... Administrative problems: theory and practice . ... Kudeev А.S., Tsilosani A.I. Implementation of corporate housing motivation programs through public-private partnership . ... Vasilyeva E.V. Problems of Regional Social and Demographic Management . Communication management and strategic communication in public administration . ... Communication Aspect of Terrorism and Counter-Terrorist Activities in Italy (2000-2012) . ... Legal and political aspects of public administration . ...

Еще в разделе: (Показать все результаты (>292) - ee-journal.spa.msu.ru/ )

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>46) - angel.cs.msu.su/ )

• Appendix A Units
• Index

Unity in the name of the Higher School I.B. Fedorov, Chairman of Rectors' Council of Moscow and Moscow Region, Rector of Moscow State Bauman Technical University, Corresponding Member of Russian Academy of Sciences. ... They help to think anew those events, which are still extremely important many years later. ... Even more, inside the higher school itself, skeptical mood prevailed at that time - just another senseless organization to waste time and efforts. ...

Еще в разделе: (Показать все результаты (>44) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/2011_09_26/4.pdf
• http://www.rsr-online.ru/doc/norm/396.doc
• http://www.rsr-online.ru/doc/norm/111.doc

... I.A. Kurova . ... The research is mainly devoted to the problems of generation, recombination and trapping of nonequilibrium carriers in amorphous hydrogenated semiconductors (a-Si:H, a-Ge:H, a-SiGe:H) and generation and relaxation of metastable states in these materials. ... Light-induced metastable states in undoped, doped and compensated a-Si:H films were studied in a wide temperature range. ... Effect of annealing on the photoelectric properties of boron-doped a-Si:H films. ...

Еще в разделе: (Показать все результаты (>56) - scon155.phys.msu.su/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>29) - talant.msu.ru/ )

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>70) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/IJBC_3body_problem.pdf
• Research interests

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "238900_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . HUGO gene identifier example: 1681 . ...

Еще в разделе: (Показать все результаты (>22) - mouse.belozersky.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Home page . ... GeneBee . ... A4 - Genebee Adaptive Automated Annotation . ... Home . Advanced query . Annotation title . ... ITA[1,1] ITA[0,1] USUAL . Additional output . ... NRAS_1 MTEYKLVVVG AGGVGKSALT IQLIQNHFVD EYDPTIEDSY RKQVVIDGET CLLDILDTAG QEEYSAMRDQ VFAINNSKSF ADINLYREQI KRVKDSDDVP MVLVGNKCDL PTRTVDTKQA HELAKSYGIP GVEDAFYTLV REIRQYRMKK LNSSDDGTQG CMGLPCVVM . ... Last updated: December 23, 2008. ...

Еще в разделе: (Показать все результаты (>183) - www.genebee.msu.ru/ )

• GeneBee service
• Genebee Predicted Annotation - Advanced

C-DVM . ... Language description . ... 6 Remote data specification . ... 6.2 Remote references of SHADOW type . ... 6.2.2 Specification of independent references of SHADOW type for one loop . 6.2.3 ACROSS specification of dependent references of SHADOW type for single loop . ... 6.3.2 Synchronous specification of remote references of REMOTE type . 6.3.3 Asynchronous specification of remote references of REMOTE type . ... 6.4.1 Synchronous specification of remote references of REDUCTION type . ...

Еще в разделе: (Показать все результаты (>122) - sp.cs.msu.ru/ )

• Fortran DVM language description
• Development of portable program system
• DVM-system. Installation guide. Version 3.95

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>134) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of
• Graduate study | Department: General Problems of Control. Faculty of Mechanics

... After checking with Australian-based colleagues on current and recent . ... geology and soil science. ... I was an active member of the Australian Committee for Stratigraphic . Nomenclature. ... incorporate into the Australian Code of Stratigraphic Nomenclature the . ... mappable unit mantle of soil (a soil stratigraphic unit), with provision . ... As conceptual stratigraphic units, paleosols are analogous to (but . ... stratigraphic units in the Australian stratigraphic code. ...

Еще в разделе: (Показать все результаты (>181) - www.fadr.msu.ru/ )

• A LITTLE COMMENT to the Commentary about Soils, Paleosols and Geosols by Vance
• The Period 1995 - 1999 of the Paleopedology Commission
• Contens

... Massjuk N.P. Cyaneliae and taxonomic status of cyanomes. ... Minicheva G.G. Morphofunctional aspects of the diversity of the body form of algae. ... Rhodophyta ) under low illumination. ... Kovalenko O.V. New data on Cyanophyta of lakes of Shatsk Nature National Park (Ukrainian Polissya). ... Palamar Mordvintseva C.W. New for Ukraine Desmidiales ( Chlorophyta ) from the Carpathian Bilosphaere Reserve (Ukraine). ... Dogadina T.V. To the memory of Alexandra Miknailovna Matvienko (1910-1996). ...

Еще в разделе: (Показать все результаты (>6219) - herba.msu.ru/ )

• Moscow environs
• img_8692.jpg
• img_8699.jpg

VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...

Еще в разделе: (Показать все результаты (>106) - hbar.phys.msu.ru/ )

• newtrev1.htm
• newtrev2.htm
• Ответ Wally на книгу "Крах С14"