... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Fortran-DVM . ... Language description . ... 2.2 Syntax of FDVM directives . ... 4.2 Distribution of dynamic arrays . ... 6 Remote data specification . ... 6.2 SHADOW type references . ... 6.2.2 Synchronous specification of independent references of SHADOW type for single loop . ... 6.2.5 Asynchronous specification of independent references of SHADOW type . ... 6.3.3 Asynchronous specification of REMOTE type references . ... 6.4.2 Asynchronous specification of REDUCTION type references . ...

Еще в разделе: (Показать все результаты (>234) - sp.cs.msu.ru/ )

• Logic and Databases
• C-DVM language description
• Кузнецов Сергей Дмитриевич

... Ariskin A.A., Bouadze K.V., Meshalkin S.S., Tsekhonya T.I. (1992) INFOREX: A database on experimental studies of phase relations in silicate systems. ... Meshalkin S.S., Ariskin A.A., Barmina G.S., Nikolaev G.S., Almeev R.R. (1996) Development of a database on experimental crystal-melt equilibria for igneous rocks: INFOREX system, version-3.0. ... Meshalkin S.S., Ariskin A.A. (1996) INFOREX-3.0: A database on experimental phase equilibria in igneous rocks and synthetic systems. ...

Еще в разделе: (Показать все результаты (>506) - geo.web.ru/ )

• Processing Experimental Data

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>67) - scon155.phys.msu.su/ )

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>72) - old.philol.msu.ru/ )

... Proceedings 2009 . Proceedings 2008 . ... Proceedings 2004 . ... The laboratory practical work is an integral part of any physical course. ... In this connection, usage of the laboratory practical work organized via a computer and information technologies is expedient. The computer allows modeling the process of carrying out experiment practically of any area of physics and makes teaching methods more visual. In the current paper the alternative of a computer practical work is offered. ...

Еще в разделе: (Показать все результаты (>352) - www.mce.biophys.msu.ru/ )

• Automated training systems TCM and TNM for support of rates of computer
• Books : Enqlish for Computer Science Students
• The applied aspects of linear algebra on the higher mathematics computer

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>24) - hcs.cmc.msu.ru/ )

• Master program "Software for Computer Networks" | Магистерское и послевузовское
• zavuch's blog | Магистерское и послевузовское образование
• Master program "Mathematical and computer methods of image processing" |

... Лекторий по физике . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра компьютерных методов в физике . ... Методы анализа и интерпретации эксперимента . Математические методы анализа и интерпретации эксперимента разрабатывались на кафедре под руководством проф. Пытьева Ю.П. более 25 лет. ... Методы позволяют эффективно учитывать симметрию решаемой задачи анализа и интерпретации, а также трудно формализуемые сведения о моделируемых объектах и явлениях. ...

Еще в разделе: (Показать все результаты (>122) - phys.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>5) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>588) - www.parallel.ru/ )

• Double Buffering with Split Collective I/O | PARALLEL.RU -
• MPI-2: Extensions to the Message-Passing Interface | PARALLEL.RU -
• MPI | PARALLEL.RU - Информационно-аналитический центр по параллельным

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2359) - swx.sinp.msu.ru/ )

• Index of /models/database/db/010128
• Index of /models/database/db/010402
• Index of /models/database/db/001108

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ... Ringing effect is usually introduced to image after different image processing algorithms. ... Scale-space method of image ringing estimation // In: Proceedings of International Conference on Image Processing (ICIP'09)...

Еще в разделе: (Показать все результаты (>324) - imaging.cmc.msu.ru/ )

• Computer Tomography image filtering | Laboratory of Mathematical Methods of
• Research | Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

The Octotron Approach: Towards Autonomous and Reliable Operation of Supercomputers Alexander Antonov, Dmitry Nikitenko, Pavel Shvets, Sergey Sobolev, Konstantin Stefanov, Vadim Voevodin, Vladimir Voevodin, Sergey Zhumatiy Research Computing Center, Lomonosov Moscow State University, Moscow, Russia {asa,dan,shpavel,sergeys,cstef,vadim,voevodin,serg}@parallel.ru 1 Introduction ... 2 The Octotron System: Model-based Approach Octotron represents the supercomputer model in the form of a graph (Fig. ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Theoretical Physics | Moscow University Supercomputing Center
• X-COM: DISTRIBUTED COMPUTING SOFTWARE | Moscow University Supercomputing Center
• AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features. From Mobile to

... file . ... Some monomer classes have the same name as per PDB database. ... 8 def __new__ ( cls , file , format = "fasta" ): . ... 17 def __init__ ( self , file , wrap_column = 70 ): . ... 21 def write_string ( self , string , name , description = '' ): . 22 """Append one sequence to file.""" . ... 34 def write_strings ( self , sequences ): . ... 55 def __init__ ( self , file , format ): . ... 69 def fix_sequences ( self , sequences ): . ... 71 for name , description , sequence in sequences : . ...

Еще в разделе: (Показать все результаты (>17439) - kodomo.fbb.msu.ru/ )

• allpy: allpy/fileio.py diff
• allpy: 21cfc7897a8f allpy/fileio.py
• allpy: a9d4a06ed103 NEWS

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>69) - www.msm.biophys.msu.ru/ )

... useful to make html . HTML-standarts . Characters for html . ... Research computing center at MSU . ... Fortran . ACME-brand Unix software . Screen Savers (Lunar craters, Sky and others for Windows and for Unix) . Golden Software: Surfer, Grapher, MapViewer and Didger . ... Scientific Research Computational Center in MSU . Fortran Library Mark 18 . NAG library . ... ISM-computers . ... White Wind - computers . R-style computers . ...

Еще в разделе: (Показать все результаты (>14) - astrometric.sai.msu.ru/ )

• Specification

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )