... GOTO 100 0038 IF(ALFA.EQ.0.) ... EPS)GOTO 2 0054 IF(ALFA.EQ.0.) ... GOTO 68 0075 K2=K2+1 0076 IF(K2.EQ.IMAX) GOTO 67 0077 X0=Y 0078 F0= AN4 0079 GOTO 23 0080 37 CONTINUE C * changing the interval 0081 X=Y 0082 F= AN4 0083 GOTO 23 0084 ENTRY PTIPRE C * entry to continue calculations 0085 ICONT=1 0086 GOTO 110 0087 64 CONTINUE C * working array is too short 0088 IERR =64 0089 GOTO 9999 0090 65 CONTINUE C * initial regularization parameter is too small 0091 IERR =65 0092 ...

Еще в разделе: (Показать все результаты (>39) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/illposed/programs/Fig4_2.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_3.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_4.txt

... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...

Еще в разделе: (Показать все результаты (>16) - anazarenko.ffl.msu.ru/ )

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>2) - depository.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>63) - chaos.phys.msu.ru/ )

... Determine type of branching, explain 3. Determine architectural model (use key from Halle et al. ... Determine phyllotaxis type and formula of spiral phyllotaxis (if applicable), explain 5. Write detailed description of leaf of each plant species (see plan below). ... Plan of leaf description: 1. General characters (leaf as a whole): (a) symmetry (symmetrical / asymmetrical); (b) stipules (present / absent, deciduous / not); (c) base (sheath / no, ligule /no, auricles /no) 2. ...

Еще в разделе: (Показать все результаты (>274) - herba.msu.ru/ )

• BIOL 310: Ethnobotany
• Systema Naturae
• Complete flora of islands and lakes as a statistical hypothesis

'mpif.h' * Именованные константы - параметры задачи INTEGER DLEN_, IA, JA, IB, JB, M, N, MB, NB, RSRC, $ CSRC, MXLLDA, MXLLDB, NRHS , NBRHS, NOUT , $ MXLOCR, MXLOCC, MXRHSC PARAMETER ( DLEN_ = 9, IA = 1, JA = 1, IB = 1, JB = 1, $ M = 9, N = 9, MB = 2, NB = 2, RSRC = 0, $ CSRC = 0, MXLLDA = 5, MXLLDB = 5, NRHS = 1, $ NBRHS = 1, NOUT = 6, MXLOCR = 5, MXLOCC = 4, $ MXRHSC = 1 ) DOUBLE PRECISION ONE PARAMETER ( ONE = 1.0D+0 ) * * Локальные переменные INTEGER ICTXT , ...

Еще в разделе: (Показать все результаты (>1434) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/meth_mat/parl_prg/pr2_3.htm
• http://num-anal.srcc.msu.su/eng_math/redict/11.htm
• http://num-anal.srcc.msu.su/eng_math/redict/8.htm

. ADDRESS/EMAIL . To receive the complete Announcement and Call for Papers, please contact with ISNA organizing committee . ISNA-16 . Department of Acoustics . Physics Faculty . Moscow State University . 119899 Moscow . Russian Federation . Web: http://acs366b.phys.msu.su/isna16 .

Еще в разделе: (Показать все результаты (>170) - acs366.phys.msu.su/ )

• Abstract
• Abstract (Invited)

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>36) - erg.biophys.msu.ru/ )

• Reaction-diffusion systems in 2D space with python ERG Research Group:
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической

Volume Functions of Historical Texts and the Amplitude Correlation Principle Anatoliy T. Fomenko* *Department of Mathematics and Mechanics, Moscow University, Leninskie Gory Moscow, 119889, U.S.S.R. and Svetlozar ... Santa Barbara, California 93106, U.S.A. Abstract: A new empirico-statistical model is suggested to distinguish dependent narrative texts from independent narrative texts by means of their ... A qualitative definition of rich and poor texts is intuitively clear (Figure 3). ...

Еще в разделе: (Показать все результаты (>97) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/ahist/antikythera2.pdf
• Historical Eclipses
• JulDate.htm

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

• Academician Aleksandr Naumovich Frumkin
• Nanostructured SnO2-TiO2 films as related to lithium intercalation

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia eґmail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the soґcalled Vґ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YґMP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>36) - observ.pereplet.ru/ )

... cheap ray bans . cheap moncler . cheap longchamp . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product Key ...

Еще в разделе: (Показать все результаты (>155) - elana.sinp.msu.ru/ )

• cheap the north face Victoria Pendleton calls for changes in PE lessons for
• moncler outlet | С Днем Победы!
• cheap the nort | С Днем Победы!

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations
• Pressure Distribution Peculiariry Along Square Canopy

... U4 of the coordinate equations. ... A The explicit form of the co ordinate equations coefficients of the coordinate equations (5) are , Y11 Y2 Y = 13 Y1 Y14 15 Y21 Y22 Y23 Y24 Y31 Y32 Y33 Y34 Y41 Y42 , Y43 Y44 The explicit expressions for the as follows ... X4 X= 1 3 3 3 3 X1 X2 X3 X4 4 4 4 4 X1 X2 X3 X4 (35) Figure 6: 3D graph of Re [v 1 ] for = 20 + i where 1 X1 1 X2 1 X3 1 X4 1 1 cos - 2(C1 + E1 ) sin , 2 sin2 ) 2(1 - cos 1 E 1 cos - C2 sin = - cos cos ...

Еще в разделе: (Показать все результаты (>44) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/prsla02.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/proc02.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/dd03proc.pdf

... IUPAC is seeking nominations for the 2016 CHEMRAWN VII Prize for Green Chemistry. The CHEMRAWN VII Prize was first announced in August 2008 and since, has been awarded every two years at the IUPAC International Conference on Green Chemistry . ... Nominations for the 2016 Prize must be submitted by 25 March 2016. ... http://www.iupac.org/news/news-detail/article/chemrawn-vii-prize-for-green-chemistry-2016-call-for-nominations.html . ...

Еще в разделе: (Показать все результаты (>396) - chem.msu.ru/ )

• Molar enthalpies of formation of indium tellurides: In4Te3 and InTe
• Entrance Examinations - Preliminary Round
• Moscow University Chemistry Bulletin Vol. 46, No. 3, P. 131 (2005)

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Guidelines
• Invited speakers
• Author Timeline

... Development of a candidate secondary reference procedure (immunoassay based measurement procedure of higher metrological order) for cardiac troponin I: I. Antibody characterization and preliminary validation. ... In this study, the first steps in the development of a secondary reference measurement procedure (RMP) 'higher metrological order measurement procedure' to support the cardiac troponin I (cTnI) standardization initiative is described. ...

Еще в разделе: (Показать все результаты (>51) - biochem.bio.msu.ru/ )

• Large potentials of small heat shock proteins.

Participants of the project . Scientific information . ... Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University ? chief developer and executor. Physics-Technical Faculty of Ulyanovsk State University. Kostroma State University. ... Contains information about space weather based on the data from GOES, ACE satellites. The project of a supersmall satellite "Baumanets" , developed by the students of Bauman Moscow State Technical University. ...

Еще в разделе: (Показать все результаты (>39) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006