The analysis of the asymptotic behavior of Ornstein - Zernike equation shows that the phase transitions on binodal cannot exist in the standard theory, which accounts for the analytical solutions only. To obtain the transitions it is necessary to build the nonlinear theory. ... It allows one to describe the critical phenomena in complete agreement with the experimental data and with the scaling theory, as well as to explain the nature of the liquid - vapor phase transitions. ...

Еще в разделе: (Показать все результаты (>254) - polly.phys.msu.ru/ )

• NATO Scientific & Environmental Affairs
• P.N.S.P.M. Lab. - Research
• KTiOPO4-FAMILY CRYSTALS

... WolfDoom for help on ambient effects and some sounds. ... You must have my permission to put on CD * Where to get this WAD * FTP sites: ftp.cdrom.com Other: Me -Build history- v0.1 *ALPHA* 12-15-1997 Released to a few friends online Basic wad functions ( music , gfx, snd) v0.2 * beta 1* DATE UKNOWN (lost track) weapons added Added dehacked patch for special effects added 2 enemies Messed up on DEH, rewrote it over. :( v0.25 * beta 2* DATE UKNOWN Ambience added ! more graphics ...

Еще в разделе: (Показать все результаты (>3169) - crydee.sai.msu.ru/ )

• Historical Notes
• Recursion
• Unsteady boundary layer transition

... Line: 1 to 1 . Welcome to TWiki, a web-based collaboration tool, document management tool, and knowledge base tool. ... Changed: . Complete documentation for Webmasters, system administrators, anyone interested in installing and fine-tuning a TWiki site. ... TWikiVariables . ... A collection of single-page topics: clear, concise how-to guides designed for busy TWiki users. ... TWikiVariables : Manipulate text, graphics, calculations, and more with simple expanding text strings. ...

Еще в разделе: (Показать все результаты (>33618) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (16 vs. 20) - TWiki
• %TOPICTITLE% (28 vs. 29) - TWiki
• %TOPICTITLE% (26 vs. 27) - TWiki

Axial Anomaly and Strange Strange Quarks FOURTEENTH LOMONOSOV CONFERENCE ON ELEMENTARY PARTICLE PHYSICS Moscow, MSU, August 21 2009 Oleg Teryaev JINR, Dubna Outline Axial anomaly for massless and massive fermions: decoupling Axial anomaly and Heavy quarks polarization in nucleon When strange quarks can be heavy: multiscale hadrons Support: small higher twist with IR QCD coupling Charm/strange universality? ...

Еще в разделе: (Показать все результаты (>219) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/epp10/Greco.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_21.pdf
• http://nuclphys.sinp.msu.ru/conf/epp10/Sizin.pdf

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>129) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications
• Department of General Mathematics | CMC MSU
• CMC MSU students at GSIS Summer School, Tohoku University, Japan | CMC MSU

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>3545) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>97) - comphep.sinp.msu.ru/ )

• news [CompHEP]
• docs [CompHEP]
• faq [CompHEP]

... H: · 1 ­ Al2O3­Na3AlF6 (T - x) = 1 , ­ , ­ 1 ( ­ ); · 1 ­ Na2SO4­H2O (T - x) = 1 ( ); · 25° ( .. ... Na2SO4­H2O Na2SO4 10H2O, Na2SO4 + 10H2O Na2SO4 10H2O. , , , . ... 6, 7) LiBr KBr, , : L LiBr() + KBr() . ... 1) , , KBr. ... L. PbTe­SnTe PbSe­SnSe PbTe PbSe, , (.. ... BeF2­LiF , ( ), LiBeF3 Li2BeF4 BeF2­LiF (. ... LiBeF3 280°, BeF2 Li2BeF4 : LiBeF3 () ­ Na2SO4 7H2O: Na2SO4 + 7H2O Na2SO4 7H2O. : Na2SO4 7H2O() Na2SO4 10H2O() Na2SO4 () Na2SO4 () +L 24° BeF2 () + Li2BeF4 () . ... Na2SO4­H2O Na2SO4­H2O....

Еще в разделе: (Показать все результаты (>59) - www.inorg.chem.msu.ru/ )

• Joint Semiconductors Surface Study group

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>160) - www.pereplet.ru/ )

... Наука и учеба . ... Публикации . ... Наука . ... 18.03.2016 . ... Главная Наука и учеба Публикации . ... Абстракт: The coherent-information concept is used to analyze a variety of simple quantum systems. Coherent information was calculated for the information decay in a two-level atom in the presence of an external resonant field, for the information exchange between two coupled two-level atoms, and for the information transfer from a two-level atom to another atom and to a photon field. ...

Еще в разделе: (Показать все результаты (>193) - ofvp.phys.msu.ru/ )

... Effect of disulfide crosslinking on thermal transitions and chaperone-like activity of human small heat shock protein HspB1. ... Temperature-induced conformational changes of reduced and oxidized HspB1 crosslinked by disulfide bond between single Cys137 of neighboring monomers were analyzed by means of different techniques. ... Oxidation resulted in decrease of chaperone-like activity of HspB1. ...

Еще в разделе: (Показать все результаты (>112) - biochem.bio.msu.ru/ )

• Inhibitory effect of palmitate on the mitochondrial NADH:ubiquinone
• Gating mechanisms of a natural anion channelrhodopsin.
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>32) - cdfe.sinp.msu.ru/ )

... Форумы > Книжная барахолка > Тема . Автор темы Lucifer . Форумы Список тем Новая тема . ... Куплю: Мейерс Effective C++ на русском . Effective C++ на русском. ... http://www.ozon.ru/context/detail/id/95276/ . ... http://www.ozon.ru/context/detail/id/117646/ . ... Следующая тема Предыдущая тема . ... Извините, только зарегистрированные пользователи могут публиковать сообщения в этом форуме. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>151) - www.mmonline.ru/ )

• MMOnline | Форумы | Книжная барахолка | Куплю: Мейерс Effective C++
• Програма конферецнии Topology, analysis and applications in mathematical
• MMOnline | Новости | Програма конферецнии Topology, analysis and applications

Еще в разделе: (Показать все результаты (>61) - num-anal.srcc.msu.ru/ )

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>145) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!

... 13, Moscow 119992, Russian Federation, e-mail: busarev@sai.msu.ru; 2 Research Institute Crimean Astrophysical Observatory, p/o Nauchnyi, Crimea 334413, Ukraine, e-mail: prok@crao.crimea.ua Summary: We propose a combined method of astronomical investigations of small or distant planets incorporating registration of a set of integral spectra of an object and their frequency analysis. ... An application of the method is shown on example of asteroid 21 Lutetia. ... 6] Busarev V. V. (2002), Solar Sys. ...

Еще в разделе: (Показать все результаты (>101) - selena.sai.msu.ru/ )

• Yurii Naumovich Lipsky
• Родионова Жанна Федоровна

... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>163) - www.enzyme.chem.msu.ru/ )

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Keldysh Institute of Applied Mathematics of RAS . DRIVER: 3D numerical modelling of high energy density plasma physics . ... AREA: Plasma Physics . ... IMPACT: The expected results of numerical experiments will help to explain the observed statistical characteristics of molecular hydrogen clouds in external galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Mechanics | Moscow University Supercomputing Center
• MSU's HPC HISTORY | Moscow University Supercomputing Center
• HOPSA - the joint RF/EU project: HOlistic Performance System Analysis | Moscow