... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DiMMon: a New Approach to Supercomputer Monitoring . ... Kazan National Research Technological University . ... AREA: Physical Chemistry, Optics and Quantum Electronics . ... Moscow State Uiversity . DRIVER: Supercomputer-aided development of new mid-infrared laser technologies. ... AREA: Optics and Quantum Electronics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>65) - hpc.msu.ru/ )

• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center
• APPLICATIONS: Fundamental Medicine and Phisiology | Moscow University

... The tool is used for translating IDL-specifications to C++ as well as feeding IDL-specifications into the interface repository. The idl tool takes its input either from a file or an interface repository and generates code for C++ or CORBA-IDL. ... This option is off by default. -codegen-c++ . ... By default, the stubs and skeletons generated by the IDL Compiler make use of an efficient MICO specific marshalling interface called the Static Invocation Interface (SII). ... idl account.idl . ...

Еще в разделе: (Показать все результаты (>412) - rtm-cs.sinp.msu.ru/ )

• Unknown Constructed Types
• Apache module mod_expires
• Example

... Форумы > Разное > Тема . ... Состоялся финал международной студенческой конференции 'IT Security for the Next Generation'. Состоялся финал международной студенческой конференции 'IT Security for the Next Generation '. 13-15 апреля в Мюнхене состоялся финал международной студенческой конференции 'IT Security for the Next Generation ', который объединил победителей всех 3-х региональных отборочных туров (Европейского, Азиатско-Тихоокеанического региона, Ближнего ...

Еще в разделе: (Показать все результаты (>84) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное

... Electromagnetic Generation of High Harmonics of Ultrasound in Magnets . ... The propagation of ultrasound in magnetoelastic materials is accompanied by generation of high harmonics due to elastic nonlinearity and effective anharmonicity of coupled acoustic and spin waves. ... The generation of high harmonics of surface acoustic waves is caused by the appearance of elastic deformations synchronized in space and time in magnet. ...

Еще в разделе: (Показать все результаты (>229) - acs366.phys.msu.su/ )

• Schedule : Nonlinear Acoustics of the Atmosphere, the Ocean, and the Earth

... Fiber optic hidrophones . ... A fiber optic air backed mandrel hydrophone to detect high energy hadronic showers in the water". ( text ) . ... The realization of an optic fiber air backed mandrel hydrophone for frequencies up to 20 kHz". ( text ) . M. Anghinolfi, A. Bersani, A. Calvi, A. Cotrufo, M. Ivaldi, O. Ershova, F. Parodi, D. Piombo, A. Plotnikov and L. Repetto "Measurement of the frequency responsivity of a fiber optic air backed mandrel hydrophone up to 10 kHz in air". ( text ) . ...

Еще в разделе: (Показать все результаты (>9) - antares.sinp.msu.ru/ )

... Key carbonatite localities that have been investigated as part of INTAS project 05-1000008-7938 ? Diamond and Graphite in Carbonate Magmas ? are: (1) Western Greenland, where the distribution of kimberlites , lamproites and carbonatites is correlated with depth to a fossil subducted slab (personal communication, Nielsen 2008); (2) the Chagatai Complex of ... Generation of carbonatitic melt through partial melting of carbonated eclogite under mantle conditions. ...

Еще в разделе: (Показать все результаты (>341) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Lapin1.htm
• http://geo.web.ru/conf/alkaline/2009/Skufin.htm
• Abstract

Provided mainly for use in templates, this macro generates the parts of the topic view that relate to meta-data (attachments, forms etc.) ... all="on" to show hidden attachments. title="..." to show a title - only if attachments are displayed. template="..." to use a custom template for the rendering of attachments; default attachtables is used. "moved" - if a topic was moved or renamed, generates a message with details and a revert link . ... This topic: System > WebHome > Macros > VarMETA . ...

Еще в разделе: (Показать все результаты (>3843) - wiki.cmc.msu.ru/ )

• PerlDoc < System < Foswiki
• VarICONURL < System < Foswiki

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• download:rn-080423 [CompHEP]
• overview [CompHEP]
• download:rn-070606 [CompHEP]

... Monitoring of population of rare orchid Epipogium aphyllum (F.W. Schmidt) Sw. on the isl. ... We counted generative shoots and flowers on them; we also checked the presence of pollinia in all flowers. We fixed four damaged by animals inflorescences (one flower, two flowers and two inflorescences with three flowers) with 70% ethanol to estimate the potential seed production. ... In the groups of generative shoots only one rhizome gave rise to the two generative shoots. ...

Еще в разделе: (Показать все результаты (>6054) - herba.msu.ru/ )

• Population of Epipogium aphyllum on the Kem?-Ludskij archipelago (White Sea)
• img_0816.jpg
• img_8966.jpg

The rise and fall of the fourth quark-lepton generation M.I.Vysotsky ITEP QFTHEP, Repino, June 26, 2013 M.I. Vysotsky The rise and fall of the fourth quark-lepton generation June 26, 2013 1 / 17 Prehistory 1974, J / (cc) discovery, "November Revolution" ? c quark - the last member of the 2nd family (c, s, ?, ? ) 1976, -lepton, 1978; (b?) b the 3rd family 1994 - t-quark, but already in the 1980s - why only 3 generations? where is the fourth generation? ... Vector generation - another story.. ...

Еще в разделе: (Показать все результаты (>177) - qfthep.sinp.msu.ru/ )

• June 26, 2013

Heat transfer intensification on surfaces with 'eddy generating' relief by subsonic incident flow velocity . ... Scheme of unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . Unit for determination of heat transfer and pressure drop coefficients (strain-gauge method) on plates with smooth relief and plates with 'eddy generating' relief . ...

Еще в разделе: (Показать все результаты (>5) - termogaz.imec.msu.ru/ )

• supersonic dimples_e
• Numeric_e
• scientific results_e

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>48) - sp.cs.msu.ru/ )

... Vol. ... Влияние рыночных отношений на организацию университетских исследований в канадских университетах: по данным опросов преподавателей в 1974-1983 и 1989-1998 гг. Ключевые слова: Высшая школа в условиях рыночной экономики. ... 2002. ... Исследовательская работа университетов США в целях национальной обороны. Ключевые слова: Наука в университетах. ... Ключевые слова: Связь университетов с промышленностью. ... Ключевые слова: Роль университетов в жизни общества. ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ...

Еще в разделе: (Показать все результаты (>76) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• H.Zhang, D.Moss, N.Kleeorin, K.Kuzanyan, I.Rogachevskii, D.Sokoloff, Y.Gao,
• Alexey N. Romanov, Zukhra T. Fattakhova, Denis M. Zhigunov, Vladimir N.

... Directives | ... Apache HTTP Server Version 2.0 . ... This module controls the setting of the Expires HTTP header and the max-age directive of the Cache-Control HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... access . ... If set to On , the headers will be added to served documents according to the criteria defined by the ExpiresByType and ExpiresDefault directives ( q.v. ). ...

Еще в разделе: (Показать все результаты (>191) - itpm.msu.su/ )

• IPC Keys
• mod_ext_filter - Apache HTTP Server
• What is a Mail Message?

Generated by Foxit PDF Creator ? Foxit Software http://www.foxitsoftware.com For evaluation only. ... MODIS/Terra, MODIS/Aqua, Aster/Terra). ... 2004. ...

Еще в разделе: (Показать все результаты (>172) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/cafedra/segzs/nauchd/pubs/Spatial_ogranization_Abler_1971.doc
• http://www.geogr.msu.ru/upload/news/Oslo_2014_arctic_course_announcement.pdf

Generated by Foxit PDF Creator ? Foxit Software http://www.foxitsoftware.com For evaluation only. 2011 1 Generated by Foxit PDF Creator ? Foxit Software http://www.foxitsoftware.com For evaluation only. ... 1.3) dt dt dt dt d y d d d (1.4) a i x j k z . ... sin d (1.6) | ... 1.49) i 1 xi2 2. xi ; yi , i ґ n ( x1 , y1 ) , ( x2 , y 2 ) , ..., ( xn , y n ) , (1.50) y ax b , 22 Generated by Foxit PDF Creator ? Foxit Software http://www.foxitsoftware.com For evaluation only. a ґ , , i2 ґ yi . ...

Еще в разделе: (Показать все результаты (>32) - genphys.phys.msu.su/ )

• Публикации

GENERATION OF PARTICLES IN VACUUM IN PRESENCE OF STRONG ELECTROMAGNETIC FIELDS S. A. SMOLYA NSKY ? ... The process of particle-antiparticle pairs generation in the presence of strong electromagnetic fields is described, using the simplest models of physical vacuum. ... Further we discuss the latest works on kinetic description of the process of particles generation in vacuum in the presence of strong non-stationary fields. ґ . 2001 =c m c +p . ... 2mc2. - - , 2mc2 2 (-) (-) . ... kin , Vmax . ...

Еще в разделе: (Показать все результаты (>154) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/240809/Pavlovsky.pdf
• http://nuclphys.sinp.msu.ru/school/s09/09_02.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_21.pdf

KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...

Еще в разделе: (Показать все результаты (>46) - old.philol.msu.ru/ )

... High Brightness RTM . ... Techniques to generate short, small emittance electron bunches of several nC at energies of several MeV are being developed to drive free electron lasers, for accelerator research, to provide short laser Thomson scattering X-ray pulses, and to generate intense coherent millimeter radiation (e.g., synchrotron, transition, etc.) ... Generating several tens of MeV beams now requires large, expensive, energy inefficient accelerators available only at large laboratories. ...

Еще в разделе: (Показать все результаты (>2) - vserv.sinp.msu.ru/ )