... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>10) - angel.cs.msu.su/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>79) - hist.msu.ru/ )

... Field of research: Extragalactic astronomy. ... NASA Astrophysics Data System (ADS) Abstract Service . ... CADC Home Page . ... CCD Images of Galaxies . ... RUSSIAN LINKS . ... UA Astronomy Personal Home Page - Bill Keel . ... The Shape of the Rotation Curves of Edge-on Galaxies, by A.V.Zasov and A.V.Khoperskov, 2003. ... A Thickness of Stellar Discs, by A.V.Zasov, and D.V.Bizyaev, 2003 . Minimum Velocity Dispersion in Stable Stellar Disks, by A.V.Khoperskov, A.V.Zasov, and N.V.Tyurina, 2003 . ...

Еще в разделе: (Показать все результаты (>48) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Test Page for Apache Installation
• Apache modules

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>220) - site2010.sai.msu.ru/ )

• Methods and instruments to measure/monitor major site properties
• General information

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2000 July 26 . Lingering Lunar Eclipse . Credit Copyright: Noel Munford (Palmerston North Astronomical Society, New Zealand) . Explanation: As the Moon passed almost directly through the center of Earth's shadow on July 16th, sky gazers in the Pacific hemisphere were graced by a lingering lunar eclipse . ... About APOD | ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: June 25, 1996 - A Star Forming Region in the LMC
• APOD: April 9, 1999 - WR 104: Pinwheel Star
• APOD: November 19, 1999 - Mercury And The Sun

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>25) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

... к почтовому серверу ГАИШ lnfm1.sai.msu.ru . ... WEB-страницы отделов ГАИШ . ... на LNFM1 . HERITAGE - АСТРОНОМИЧЕСКОЕ НАСЛЕДИЕ . астрономическое образование с сохранением традиций) . Лаборатория Новых Фотометрических Методов . ... Леонтьев Сергей Ефимович . ... Копаев Александр А. Отдел Радиоастрономии . Татарников Андрей М. Пахомов Юрий . ... Гусев Александр Сергеевич . ... Кононович Эдвард В. Купряков Юрий А. Горшков Алексей Б. Отдел Звездной астрофизики . ... Моисеев Алексей . ...

Еще в разделе: (Показать все результаты (>374) - lnfm1.sai.msu.ru/ )

• Celestial Mechanics
• Scientific activity
• HSFA 2 technical description Technical Details

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>197) - itpm.msu.su/ )

• Basic HTML data types
• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>58) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>123) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>90) - uneex.mithril.cs.msu.su/ )

• HelpOnFormatting - UNИX
• Index of /static/DocsKdeOrg_KControl/kde3/ru/kdebase/kcontrol/colors
• HelpOnTables - UNИX

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>56) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Research
• Intelligent Systems :: Research :: :: Articles

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

.

56. LangueDOC :: Movie

57. Leading scientific fellow Sergey Piskarev Ph.D.

58. Об эффективности хирургической коррекции дефекта межжелудочковой перегородки у

59. Towards Automatic Stereo-video Quality Assessment and Detection of Color and