Backlinks to TemplateTopics in System Web ( Search all webs ) . ... Related topics: CommentPluginTemplates, .CommentPluginExamples .. NEW - 10 Apr 2011 - 18:03 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... TemplateTopics has more) . ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... NEW - 05 Nov 2010 - 13:09 by ProjectContributor . ...

Еще в разделе: (Показать все результаты (>1876) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) TemplateTopics < System < Foswiki
• HistoryPlugin < System < Foswiki
• (backlinks in System Web) CommandAndCGIScripts < System < Foswiki

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>49) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>37) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>50) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyright©1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>13) - www.issp.ac.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>101) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>1563) - www.philol.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>183) - srcc.msu.ru/ )

• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>132) - sp.cs.msu.ru/ )

• DVM debugger. Detailed design. Part 4
• Fortran DVM language description. Part 3 (7-12)

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>255) - phys.msu.ru/ )

• http://phys.msu.su/rus/about/structure/admin/EPFL.doc

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>403) - acs366.phys.msu.su/ )

• General Information

Canadian Paper Money]   [Canadian Paper Money - Questions & Answers] . ... a) a current bank-note or current paper money, or . ... a) all or part of a current bank-note or current paper money, or . ... b) except for the word "Canada", nothing having the appearance of a word, letter or numeral was a complete word, letter or numeral; . ... e) nothing in the likeness or appearance of the back of a current bank-note or current paper money was published or printed in any form. ...

Еще в разделе: (Показать все результаты (>530) - xray.sai.msu.ru/ )

• Case B: #tex2html_wrap_inline768#
• Wolf-Rayet and He stars (stage IV)
• Космические лучи и климат

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>584) - herba.msu.ru/ )

• Publications about flora
• Фото острова Красный
• Complete flora of islands and lakes as a statistical hypothesis

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>184) - www.prof.msu.ru/ )

• Small Grants for Russian Fulbright and Humphrey Alumni, Fall 2006
• Institute of Civilization

... Payment is made at transfer of means for the University account All expenses of transferring the money to the University account are beard by the Student. In the event the Student is expelled by the University for the lack of academic progress; transgression of the sections stated in Article 3; for the Student's own personal reasons; for medical reasons confirmed by the official medical paper, all payments made are non-refundable. Article 2 Obligation and rights of the University 2.1. ...

Еще в разделе: (Показать все результаты (>60) - foroff.phys.msu.ru/ )

• Admission Regulation

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

59. А.В.Засов. Задача 01: Определение красного смещения галактики.

60. http://shamolin2.imec.msu.ru/art-136-1.pdf