... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Коллекция публикаций о времени, собранная Семинаром . J. T. Fraser. A Report on the Literature of Time, 1900-1980< . ... The Study of Time IV, 1981, Springer-Verlag, pp. ... The entries were selected by the standard of whether they do, in some ways, extend the concerns of the papers included in the four volumes of The Study of Time. ... There seems to be sufficient material in the periodical literature to supply a comparable number of entries for a multidisciplinary bibliography of time. ...

Еще в разделе: (Показать все результаты (>399) - chronos.msu.ru/ )

• Russian Interdisciplinary Temporology Seminar
• The Finite and the Infinite: A New view on the problem

... The date of the Department creation: January, 31, 2000. Place of the Department Яreation: Institute of Physical Chemical and Biological Problems in Soil Science, Russian Academy of Sciences (IPBPSS RAS). Pushchino, Moscow oblast', Russia 142290. ... Impressions about Visits to the USA (in Russian) . ... Creation and development of WebSite of the Department . Consultation of grantees leaving to the USA . Organization of meetings with the grantees coming from USA . ...

Еще в разделе: (Показать все результаты (>105) - www.prof.msu.ru/ )

• Advanced Studies - Study Visits

Near-surface inhomogeneities are the source of geological noise and their influence give the main part of total field dispersion. Nearly 70% of all VES curves are distorted by geological noise. The most reliable approach to VES data processing on our opinion consist in canceling geological noise before interpretation. ... For effective canceling geological noise the special electrical sounding technology is needed. ... A.A.Bobachev, I.N.Modin, E.V.Pervago, V.A.Shevnin. ... I.N.Modin. ...

Еще в разделе: (Показать все результаты (>44) - geophys.geol.msu.ru/ )

• TES tecnology. MSU.

... Monitoring of population of rare orchid Epipogium aphyllum (F.W. Schmidt) Sw. on the isl. ... We counted generative shoots and flowers on them; we also checked the presence of pollinia in all flowers. We fixed four damaged by animals inflorescences (one flower, two flowers and two inflorescences with three flowers) with 70% ethanol to estimate the potential seed production. ... In the groups of generative shoots only one rhizome gave rise to the two generative shoots. ...

Еще в разделе: (Показать все результаты (>6125) - herba.msu.ru/ )

• Population of Epipogium aphyllum on the Kem?-Ludskij archipelago (White Sea)

... PyMol is a powerful drawing instrument and here we show how to plot Fukui function with PyMOL after two calculation steps with FireFly (PC-GAMESS). ... Because total HOMO orbital have two electrons and should be divided by two (see equations at the beginning). 1 комментарий " Building and plotting Fukui function with FireFly and PyMol " . Quantum chemistry information page ERG Research Group: Лаборатория теоретической биофизики написал (Май 20th, 2015 12:43 пп) . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>29) - erg.biophys.msu.ru/ )

• Using Firefly/GAMESS-US efficiently ERG Research Group: Лаборатория
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической
• PyMol script for scanning potential energy surfaces ERG Research Group:

Appendix?аB.?а Reporting Bugs and Requesting Enhancements . ... Reporting the Bug . ... The only thing you do differently is to mark the report as an тАЬ enhancement тАЭ at the appropriate stage, as described below. ... Set this to тАЬ GIMP тАЭ . ... If in spite of your best efforts, you file a bug report and it ends up being resolved as тАЬ Duplicate тАЭ, don't be too upset: it has happened repeatedly to the author of this documentation, who works with GIMP Bugzilla nearly every day. ?а . ...

Еще в разделе: (Показать все результаты (>2219) - uneex.lorien.cs.msu.su/ )

• mod_status - Apache HTTP Server
• mod_ext_filter - Apache HTTP Server
• mod_expires - Apache HTTP Server

... Stability of calls in the red-breasted geese ( Branta ruficollis ): pilot tests in captivity for future vocal monitoring in the field // Advances in Ethology. ... In total for five seasons discriminant analysis on 55 temporal, frequency and power parameters showed 86% of correct assignment to individual (n=430 calls from 22 birds; 16-20 calls per bird) and 87% of correct assignment to sex (n=125 calls; 22 males, 3 calls per male; 12 females, 4-5 calls per female). ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>56) - vertebrata.bio.msu.ru/ )

... Hamiltonian Systems and the Generation of Vortex Structures in Fluid Motion . ... It followes in this case that there exists the coordinate system such that the evolution of two of the coordinates is governed by a time-dependent Hamyltonian system with the evolution of remaining coordinate being governed by a first order differential equation that depends only on the other two coordinates and time. ... The process of arising, evolution and disappearance of the vortex structures is described. ...

Еще в разделе: (Показать все результаты (>178) - acs366.phys.msu.su/ )

• Abstract (Invited)

. Edward Gindin . The Gallery . To contact the artist . email: edwardgindin@yahoo.com . Hall 1 . Click to enter Hall 2 . Click to enter Hall 3 . Click to enter Hall 4 .

Еще в разделе: (Показать все результаты (>2) - music.genebee.msu.su/ )

Aleksanteri Institute Visiting Scholars Programme Aleksanteri Visiting Fellowships 2013 ґ2014 THE FELLOWSHIP Is intended for scholars who hold a PhD degree in a field relevant to the Aleksanteri Institute 's research agenda and whose place of residence i s outside of Finland Is for a period of two to three months between August 2013 and June 2014 Involves a research stay at the Aleksanteri ... An electronic application form 2. ... The applications are evaluated by three experts. ...

Еще в разделе: (Показать все результаты (>90) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Aleksanteri_Visiting_Fellowships_2011-2012.pdf
• С 19 по 30 июня прошла очередная (вторая) стажировка студентов программы MBA -
• The Ljubljana Summer school

... Custom Query . ... Component . ... automata io requirements ui . ... And   Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or   Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Owner Type Status Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>1400) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata

The QProgressBar widget provides a horizontal progress bar. ... Inherits QFrame . ... QProgressBar ?(?QWidget?*?parent=0, const?char?*?name=0, WFlags?f=0?)? . QProgressBar ?(?int?totalSteps, QWidget?*?parent=0, const?char?*?name=0, WFlags?f=0?)? . int? totalSteps ?()?const . int? progress ?()?const . ... virtual?bool? setIndicator ?(?QString?&?progress_str, int?progress, int?totalSteps?)? . ... See also: QProgressDialog and GUI Design Handbook: Progress Indicator . ...

Еще в разделе: (Показать все результаты (>495) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QIntCache Class
• Apache module mod_expires
• Dynamic Invocation Interface

CUDA Device Query (Driver API) statically linked version There are 4 devices supporting CUDA Device 0: GeForce GTX 295 CUDA Capability Major revision number : 1 CUDA Capability Minor revision number : 3 Total amount of global memory: 939524096 bytes Number of multiprocessors: 30 Number of cores: 240 Total amount of constant memory: 65536 bytes Total amount of shared memory per block: 16384 bytes Total ...

Еще в разделе: (Показать все результаты (>83) - classic.chem.msu.su/ )

• PC GAMESS benchmarks and scalability on Dunnington system (four six-core Intel
• PC GAMESS benchmarks and scalability on Tigerton system (four quad-core Intel
• GeForce GTX 280 configuration and driver details

Research Fellow . ... Dept. of Physics, Moscow State University, . ... MS (Physics), Moscow State University, Moscow 1989. PhD (Physics), Moscow State University, Moscow 1992; . Thesis Title: "Second harmonic generation in metallic and semiconductor monocrystals and anisotropic Langmuir-Blodgett films". ... Research Associate, Physics Department, Moscow State University, from 1996 . Nonlinear optics of surfaces, buried interfaces, nanostructures and low-dimensional systems; . ...

Еще в разделе: (Показать все результаты (>37) - shg.phys.msu.ru/ )

• CURRICULUM VITAE
• Milestones of the lab highway

... PREV CLASS NEXT CLASS . ... Use with MultiArrayProxy to reduce apparent rank by merging adjacent dimensions. ... FlattenMap ( ConcreteIndexMap prev, int position) . Create an ConcreteIndexMap which merges two adjacent dimensions. ... position - this dimension and dimension (position +1) will appear as a single dimension. public FlattenMap ( ConcreteIndexMap prev, int position) . ... prev - ConcreteIndexMap to be composed with this. position - this dimension and dimension (position +1) . ...

Еще в разделе: (Показать все результаты (>189) - angel.cs.msu.su/ )

• Generated Documentation (Untitled)
• Index

... Program of the Course of Radio Astronomy . Moscow State University , Physics Department , Astronomy Division , 4 th year, 60 hours in total) . ... Molecular maser emission. ... The emission of the interstellar neutral hydrogen. ... Pacholczyk, A. G. Radio Astrophysics, W. H. Freeman & Co., ... Frontiers of Astrophysics, Avrett, E. H., ed., Harvard University Press, Cambridge, Mass., ... Kaplan, S. A., Pikelner, S. B. The Interstellar Medium, Harvard University Press, Cambridge, Mass., ...

Еще в разделе: (Показать все результаты (>113) - comet.sai.msu.ru/ )

• Unplugged in Charlottesville (1995)
• Examples of Bourne shell scripts
• Listing directories on the remote host

The Program: Moscow State University?s Faculty of History invites applications from scholars, graduate students and undergraduates wishing to spend a sabbatical semester or year abroad conducting academic research in the history of Russia, the Soviet Union, and the Soviet successor states. All visiting scholars and students will have the unique opportunity to participate in the rich intellectual life of the Faculty of History?s community, partaking in its activities. ... Moscow State University . ...

Еще в разделе: (Показать все результаты (>47) - www.hist.msu.ru/ )

• Aurgument_reality : Virtual tour generated by Panotour

... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate ...

Еще в разделе: (Показать все результаты (>81) - elana.sinp.msu.ru/ )

• di creativo totale attenzione.encrusting con 334 diamante di peso molto few.56
• north face outlet uk as well as increasing interest from companies throughout
• longchamp outlet 2004 Internet exchange operator Terremark Worldwide Inc. The

... О физическом факультете . ... Помощь факультету . ССО факультета . ... Система электронного документооборота (СЭД) МГУ . Удаленный доступ к информационным ресурсам физфака . ... Физический факультет . ... Наш факультет . Новости факультета . ... Журнал "Вестник МГУ. Физика, Астрономия" . Журнал "Ученые записки физич. факультета МГУ" . Онлайн доступ к научным журналам и книгам . ... Публикации . ... Журнал "Ученые записки физического факультета МГУ" . ... Список учебных курсов . ...

Еще в разделе: (Показать все результаты (>149) - phys.msu.ru/ )

• Title
• Сотрудники физического факультета МГУ
• Музей (Visit in the Museum of the Faculty of Physics)