... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
... Камерный оркестр МГУ . ... http://blankov.narod.ru - информация о старинной музыке, ее исследователях и интерпретаторах . http://www.dk.msu.ru - . ... http://www.rbsp.org/EMLinks/ - Общество R&B - коллекция сайтов по старинной музыке . ... http://classicalmus.interspeed.net/earlyperf.html - Старинная музыка - солисты и ансамбли . http://classicalmus.interspeed.net/early/index.html - Старинная музыка в Интернете . ... http://www.medieval.org/emfaq/ - Старинная музыка (FAQ) . ...
... 24 June (Monday) from 8.30 onwards Registration of the participants at the Workshop ( foyer of the Cultural Center (CC) in the MSU main building) 10.00 - 11.00 Workshop opening session (CC Large Hall ) 11.00 - 11.30 Coffee-break (CC foyer ) 11.30 - 13.30 Plenary session (CC Large Hall ) 13.30 - 15.00 Lunch 15.00 - 16.30 Parallel sessions 16.30 - 17.00 Coffee-break (CC foyer ) ... This information may be helpful if you travel on your own. ...
... Институт стран Азии и Африки МГУ . О кафедре . ... ИСАА МГУ . ... Малый факультет . ... Публикации . Публикации о ЦИЕЦ . Публикации преподавателей . ... Заведующий кафедрой . Ковельман Аркадий Бенционович . ... Объявлен новый набор на Малый Факультет Иудаики! ... Малый Факультет . ... Начало занятий Малого факультета Иудаики 16 сентября в 12.00 по адресу Большая Никитская, 47/3 . ... Фонд Ави Хай, Фонд Чейза, Фонд Ха Надив, Сохнут, Джойнт, Российский Еврейский Конгресс ...
... Общие положения. a. Лучи в оптических волокнах b. Моды оптических волноводов c. Константа распространения, фазовая и групповая скорости 2. ... Ход лучей в оптическом волноводе Волоконно-оптический волновод состоит из стеклянной сердцевины, окруженной оболочкой с меньшим значением показателя преломления. ... В плоском волноводе направляемые моды соответствуют парам лучей, одинаково наклоненным к оси, в круглых волноводах такие пары лучей необходимо заменить сложным конусом лучей. ...
[
Текст
]
Ссылки http://optics.phys.msu.ru/eng/wp-content/uploads/sites/4/2014/11/40_fiber01.pdf -- 374.1 Кб -- 10.06.2015 Похожие документы
Letter pubs.acs.org/NanoLett Enhanced Third-Harmonic Generation in Silicon Nanoparticles Driven by Magnetic Response Maxim R. Shcherbakov,*, Dragomir N. Neshev, Ben Hopkins, Alexander S. Shorokhov, Isabelle Staude, Elizaveta V. Melik-Gaykazyan ... In our experiment, we address silicon nanodisks placed on silica as shown in Figure 1. ... The THG resonance is seen to be split into two. ... We extract the electric and magnetic dipole 6490 Letter Figure 3. (a) THG spectroscopy of Si nanodisk arrays. ...
Two years later: benchmarking Firefly version 8.0.0 beta on Intel Core i7 2600K AVX-enabled system . ... Hyperthreading that works: testing Intel Core i7 940 CPU with PC GAMESS/Firefly v. 7.1.F . ... PC GAMESS v. 7.1.9 performance and scalability on 24-core Intel Dunnington (Xeon L7455)-based system . ... PC GAMESS v. 7.1 performance and scalability on 16-core Intel Tigerton (Xeon X7350)-based system . ... PC GAMESS v. 7.0.2 benchmarks on four-core Intel Kentsfield (Core 2 Quadro) system . ...
Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 29 мая 2008 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую программу "Арии, романсы русских и зарубежных композиторов" в исполнении студентов, аспирантов, преподавателей и выпускников МГУ. ... Полную версию программы концерта можно посмотреть здесь. 25 мая 2007 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую концертную программу. ... Начало концерта в 19.00 в фойе КЦ МГУ . ... Вокальный класс КЦ МГУ . ... Вокальные События в КЦ МГУ . ...
Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf -- 2354.3 Кб -- 18.10.2010 Похожие документы
... СОСТОЯНИЕ ОЧЕРЕДЕЙ И ЗАДАЧ . ... Параметры очереди . ... Параметры задачи в очереди . ... Параметры показа . ... Очередь . все regular hdd hddmem bigmem main . ... Обновлять каждые сек. показать . ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... МГУ . ИСАА . ... Вакансии . ... Студ.организации ИСАА . ... Карьера и работа . ... Отправлено 28 мар. 2012 г., 12:22 пользователем Oleg Savvateev љ [ обновлено 2 апр. 2012 г., 5:14 ] . Ассоциация предпринимателей Китая предлагает трудоустройство в представительствах китайских компаний в Москве!љ ... Есть вакансии как на полный рабочий день, так и предполагающие частичную занятость. ... Журналист, удаленная работа, частичная занятость; . ... Авторские права ї 2012 Студенческий комитет ИСАА МГУ. ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...