... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

You are here: Foswiki > System Web > JQueryPlugin > JQueryMasonry (revision 2) E dit A ttach . Homepage: http://desandro.com/resources/jquery-masonry . ... Masonry is a layout plugin for jQuery. ... Whereas floating arranges elements horizontally then vertically, Masonry arranges elements vertically then horizontally according to a grid. ... Depending on the layout, you?ll most likely need to specify one option. ... Lorem ipsum dolor sit amet, consectetuer adipiscing elit. ... System . ...

Еще в разделе: (Показать все результаты (>548) - wiki.cmc.msu.ru/ )

e mail: level_s@rambler.ru) , , , , , , , , conflict theory, social order, functionalism, social integration, system integration, Talcott Parsons, Ralf Dahrendorf, John Rex, David Lockwood . ... The theory of the conflict proceeds from belief that society always contains fundamental conflicts of interest and that social order is achieved by balance of power in which the interests of the stronger successfully contain and channel the demands of the weaker. ...

Еще в разделе: (Показать все результаты (>5) - vestnik.socio.msu.ru/ )

Title Author Key words Theories of social mobility in the history of sociological thought Baturenko S.A. theories of social mobility, social stratification, Karl Marx, Pitirim Sorokin, Reinhard Bendix, Seymour Martin Lipset, David Glass In this article evolution of theories of social mobility in the history of social thought from the classical period of development until the end of the XX century is analyzed. ...

Еще в разделе: (Показать все результаты (>3) - www.socio.msu.ru/ )

... Pleistocene soils older than Wisconsin Age are preserved only locally in the Driftless Area of Wisconsin, USA. ... Our longest known sequence is at Oil City, Wisconsin, were a 9 m section contains 5 loesses and 3 colluvial deposits with 5 buried soils; all are Except the mid-Wisconsin Farmdale soil, all of the buried soils at Oil City have argillic horizons and are intensely weathered. ... However, few buried soils have all genetic horizons preserved. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>26) - www.fadr.msu.ru/ )

... Vector Processors: Historical Perspectives . ... The first vector machines were the CDC STAR-100 and the TI ASC, both announced in 1972.Both were memory-memory vector machines. ... Convex started with a uni-processor vector machine (C-1) and now offers a small multiprocessor (C-2); they emphasize Cray software capability. Alliant has concentrated more on the multiprocessor aspects; they build an 8-processor machine, with each processor offering vector capability. ... Центры . ...

Еще в разделе: (Показать все результаты (>54) - www.parallel.ru/ )

• Bibliography | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI: Message Passing Interface - русскоязычная страница | PARALLEL.RU -

Vespertilio 17: 127ґ128, 2014 ISSN 1213-6123 New records of the bat fly Basilia mongolensis in the mountains of Asia (Diptera) Maria V. o rlova & Alexandr V. Z higalin National Research Tomsk State University, 36, Lenina str., ... In total, 12 specimens were collected from five individuals of the David's Myotis Myotis davidii (Peters, 1869). These findings specify the range of this poorly known bat ectoparasite species in Central Asia and southern Siberia (the northern margin of its distribution). ...

Еще в разделе: (Показать все результаты (>173) - zmmu.msu.ru/ )

• Types Database

Business English Certificate), ICM (The Institute of Commercial Management) Diploma In Business English, LCCI (The London Chamber of Commerce and Industry) English for Business. 1 . ... P.Strutt, Longman Business English Usage, p. 6-9, 31. ... Leo Jones, Richard Alexander, New International Business English, Cambridge University Press, 1996. ... Andrew Littlejohn, Company to Company, A new approach to business correspondence in English, Cambridge University Press, 1998. ...

Еще в разделе: (Показать все результаты (>43) - ffl.msu.ru/ )

... Laboratory "Сryoelectronics" . Dagesyan, S., Stepanov, A., Soldatov, E., and Zharik, G. High-temperature single-electron transistor based on a gold nanoparticle. ... 94400P?1?94400P?6. ... Home . Research groups . Molecular single-electronics . ... Devices based on LTS and HTS . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>2) - cryolab.phys.msu.ru/ )

• Molecular single-electronics

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>2) - compmech.math.msu.su/ )

... Parent Directory - affreschi di michelangelo 1.JPG 01-Dec-2012 15:08 1.2M affreschi di michelangelo 2.JPG 04-Dec-2012 00:00 1.5M arno.JPG 01-Dec-2012 13:00 1.1M david.JPG 03-Dec-2012 23:52 1.4M duomo 1.JPG 03-Dec-2012 23:52 1.5M duomo 2.JPG 03-Dec-2012 23:52 1.4M duomo 3.JPG 03-Dec-2012 23:59 2.0M firenze 1.JPG 01-Dec-2012 13:17 1.4M firenze 2.JPG 01-Dec-2012 13:17 1.3M firenze 3.JPG 01-Dec-2012 12:25 ...

Еще в разделе: (Показать все результаты (>8) - higeom.math.msu.su/ )

... 2 Ї ґ , , Ї ґ Ї ґ , 03.12.2015 . ... 14 03.12.2015 Ї Ї Ї 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>2) - lvk.cs.msu.su/ )

... О UNИX . ... George Tarasov . Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать страницы ------------------------ ...

Еще в разделе: (Показать все результаты (>29) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/PackageMaintaining2009/11 - UNИX

... Faculty of Physics . M.V.Lomonosov Moscow State University . ... Source: Server administrator . ... M.V.Lomonosov Moscow state University announced a competition for the schoolboys within the frame of the project targeted at launching a sputnik by the university by the 250th jubilee of Moscow state. ... Conference web-site . ... 01.05.2003 New web-site . A new web-site of the Faculty of Physics, which has both a new structure and graphics design, has been launched to the test exploitation. ...

Еще в разделе: (Показать все результаты (>43) - phys.msu.ru/ )

• Нобелевская премия по физике за 2004 г.
• Новости
• Лекция Нобелевского лауреата Джоржа Смута (Lecture of Nobel Llaureate George

В каталоге приведены названия морфологических типов рельефа Меркурия на русском и латинском языках, даны координаты объектов в гермесографической системе координат, а также исторические и библиографические сведения о происхождении названий. ... Названия присвоены 495 кратерам, диаметром от 0,93 км до 716,12 км. ... Долинам Меркурия присвоены названия 5 древних городов мира. ... Dictionary of Mythology, Folklore, and Symbols (in 3 vols.), by Gertrude Jobes; Scarecrow Press, Inc., New York, 1962. ...

Еще в разделе: (Показать все результаты (>6) - selena.sai.msu.ru/ )

. Общая информация . История . Наши задачи . Пользователи сети . Карта сети . Статистика сети . Правила сети . Фотогалерея . Контактная информация . Схема проезда . Книга гостей . 'Радио-МГУ' в лицах . Ермаков Георгий Георгиевич .

Еще в разделе: (Показать все результаты (>2) - www.radio-msu.net/ )

... G. F. Handel: Messiah - Part the First . ... Accompagnato (tenor) Comfort ye my people, saith your God. ... Prepare ye the way of the Lord, . ... Chorus And the glory of the Lord shall be revealed, . ... Isaiah 40:1-5) . ... behold, He shall come, saith the Lord of Hosts. ... and the glory of the Lord is risen upon thee. ... Behold the glory of the Lord is risen upon thee. ... которые содержали ночную стражу у стада своего. 14b. Accompagnato (soprano) And lo, the angel of the Lord came upon them, . ...

Еще в разделе: (Показать все результаты (>11) - music.genebee.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...