... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Authors: Emily M. Levesque et al. arxiv:1406.0488 Компаньон с массой 1.05 солнечных для PSR J2222-0137: самый холодный из известных белых карликов? A 1.05 $M_\odot$ Companion to PSR J2222-0137: The Coolest Known White Dwarf?) ... Authors: Lidia M. Oskinova et al. обзор arxiv:1406.1357 Образование планет в двойных (Planet formation in Binaries) . ... обзор arxiv:1406.5604 Глобальные модели образования и эволюции планет (Global Models of Planet Formation and Evolution) . ...

Еще в разделе: (Показать все результаты (>245) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1506.html
• http://xray.sai.msu.ru/~polar/sci_rev/0902.html
• http://xray.sai.msu.ru/~polar/sci_rev/0406.html

... Pleistocene soils older than Wisconsin Age are preserved only locally in the Driftless Area of Wisconsin, USA. ... Our longest known sequence is at Oil City, Wisconsin, were a 9 m section contains 5 loesses and 3 colluvial deposits with 5 buried soils; all are Except the mid-Wisconsin Farmdale soil, all of the buried soils at Oil City have argillic horizons and are intensely weathered. ... However, few buried soils have all genetic horizons preserved. ... Back to the Abstracts list ...

Еще в разделе: (Показать все результаты (>27) - www.fadr.msu.ru/ )

... Vector Processors: Historical Perspectives . ... The first vector machines were the CDC STAR-100 and the TI ASC, both announced in 1972.Both were memory-memory vector machines. ... Convex started with a uni-processor vector machine (C-1) and now offers a small multiprocessor (C-2); they emphasize Cray software capability. Alliant has concentrated more on the multiprocessor aspects; they build an 8-processor machine, with each processor offering vector capability. ... Центры . ...

Еще в разделе: (Показать все результаты (>52) - www.parallel.ru/ )

• Bibliography | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI: Message Passing Interface - русскоязычная страница | PARALLEL.RU -
• MPI: A Message-Passing Interface Standard | PARALLEL.RU -

Vespertilio 17: 127­128, 2014 ISSN 1213-6123 New records of the bat fly Basilia mongolensis in the mountains of Asia (Diptera) Maria V. o rlova & Alexandr V. Z higalin National Research Tomsk State University, 36, Lenina str., ... In total, 12 specimens were collected from five individuals of the David's Myotis Myotis davidii (Peters, 1869). These findings specify the range of this poorly known bat ectoparasite species in Central Asia and southern Siberia (the northern margin of its distribution). ...

Еще в разделе: (Показать все результаты (>345) - zmmu.msu.ru/ )

Вы будете удивлены, как много людей в разных странах фотографируют полярные сияния. ... This site is an attempt to collect information on the professional and amateur auroral photographers and to allow you to enjoy the beauty of polar aurora . ... This foto was made by S.-I. Akasofu, one of the leading auroral physic scientists. ... Sodankyla Geophysical Observatory, Finland. это снимки Ярослава Алексеевича Сахарова, ученого секретаря Апатитского отделения ПГИ . ...

Еще в разделе: (Показать все результаты (>49) - www.kosmofizika.ru/ )

... ANCIENT ASTRONOMICAL OBSERVATIONS . ... Ancient Medieval Eclipses in European Sources . ... Wayne Mitchell, Ancient Astronomical Observations and Near Eastern Chronology . ... Map showing ancient solar eclipses 1890 . ... On the rectification of chronology by means of ancient eclipses , 04/1891 . ... Ancient chronology and eclipses 9/1891 . ... Ancient chronology and eclipses-a reply 01/1893 . Ancient eclipses and chronology 03/1893 . ... On the value of ancient solar eclipses 1905 . ... COMETS: . ...

Еще в разделе: (Показать все результаты (>46) - hbar.phys.msu.ru/ )

... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>2) - compmech.math.msu.su/ )

... Parent Directory - affreschi di michelangelo 1.JPG 01-Dec-2012 15:08 1.2M affreschi di michelangelo 2.JPG 04-Dec-2012 00:00 1.5M arno.JPG 01-Dec-2012 13:00 1.1M david.JPG 03-Dec-2012 23:52 1.4M duomo 1.JPG 03-Dec-2012 23:52 1.5M duomo 2.JPG 03-Dec-2012 23:52 1.4M duomo 3.JPG 03-Dec-2012 23:59 2.0M firenze 1.JPG 01-Dec-2012 13:17 1.4M firenze 2.JPG 01-Dec-2012 13:17 1.3M firenze 3.JPG 01-Dec-2012 12:25 ...

Еще в разделе: (Показать все результаты (>15) - higeom.math.msu.su/ )

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>2) - lvk.cs.msu.su/ )

... MSU Chamber Orchestra . ... Concerto МГУ . ... music of XVI - XVIII cc. ... Natalia AZARKINA, Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Metro station "Riazanskij prospekt", "Vyhino"; buses 208, 133 . ... Alexander Konstantinov, music director . ... Sarra - Galina ZHUKOVSKAYA (soprano) . ... Olga NAZAIKINSKAYA (soprano) . ... Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Vladimir DROZDOV ( viola da gamba) . ... Olga ZHUKOVA, Alexander KONSTANTINOV . ... Olga NAZAJKINSKAJA soprano . ...

Еще в разделе: (Показать все результаты (>2) - music.genebee.msu.su/ )

• Bach suite

... Faculty of Physics . M.V.Lomonosov Moscow State University . ... Source: Server administrator . ... M.V.Lomonosov Moscow state University announced a competition for the schoolboys within the frame of the project targeted at launching a sputnik by the university by the 250th jubilee of Moscow state. ... Conference web-site . ... 01.05.2003 New web-site . A new web-site of the Faculty of Physics, which has both a new structure and graphics design, has been launched to the test exploitation. ...

Еще в разделе: (Показать все результаты (>31) - phys.msu.ru/ )

• Нобелевская премия по физике за 2004 г.
• Новости
• Физический факультет МГУ им. М. В. Ломоносова

... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! Add me to your mailing list for special offers . ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Your hotel was so nice. ...

80. Lesson 3: two methods for preparing Firefly' input files with basis sets and