... О центре . ... План тестирований по общим и теоретическим курсам на весенний семестр 2016 г. (возможны уточнения): . ... Молекулярная физика - в середине и в конце семестра . Математический анализ - в середине и в конце семестра . Линейная алгебра - в середине и в конце семестра . ... Оптика - в середине и в конце семестра . ... Центр контроля качества образования поздравляет всех студентов и преподавателей с началом семестра! ... Последнее обновление 06/04/2016 Физический факультет МГУ. ...

Еще в разделе: (Показать все результаты (>35) - ckko.phys.msu.ru/ )

... If you decline, and ask him again later, he will then ask you for 300 caps. ... You could convince (bribe) her to give you 300 caps in order for you to tell Moriarty she?s gone. ... You could ask her for no money at all, and tell Moriarty that she?s gone, resulting in Positive Karma, though you still have to come up with 100 or 300 caps to give to Moriarty. ... If you choose to do this for him (after finding out about your father on your own by talking to Dr. michael kors outlet uk . ...

Еще в разделе: (Показать все результаты (>18) - elana.sinp.msu.ru/ )

• north face outlet uk as well as increasing interest from companies throughout
• michael kors outlet uk which is accessible via the Internet as a Web server.

CUDA Center of Excellence NVIDIA 22 ? ? ґ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - ? ? : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>41) - geophys.geol.msu.ru/ )

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>26) - hcs.cmc.msu.ru/ )

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... Input parameters Key parameters: - sqrt(s), GeV N events ґ total number of events A number of target/projectile B min, B max ґ impact parameters (in fm) for all events Choice of parton-hadron conversion scenario (AMPT model, AMPT with string and others) Parameters for Lund fragmentation Quenching flag (on\off) K short decay flag, other flags Output parameters Output file: ampt.dat, containts: Event number Impact parmeter Total number of participants n. in proj. ...

Еще в разделе: (Показать все результаты (>35) - lav01.sinp.msu.ru/ )

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Вт Май 4 17:13:54 MSD 2010 . ... Крайний срок представления докладов - 1 июня 2010 г. http ://agora.guru.ru/abrau ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Appro выпускает сервера Tetra в форм-факторе 1U, включающий два процессора Intel Xeon или AMD Opteron и четыре ГПУ NVIDIA Tesla M2050. http ://www.appro.com/press/view.asp?Page=1 Num=192 + Выпущена версия 2.1 программного обеспечения ATI Stream Software Development Kit ...

Еще в разделе: (Показать все результаты (>15) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #332 [11/09/2012]

Nuclear Instruments and Methods in Physics Research B 206 (2003) 902ґ906 www.elsevier.com/locate/nimb Generation of the large current cluster ion beam T. Seki a c a,b,* , J. Matsuo a, G.H. Takaoka a, I. Yamada b,c Ion Beam Engineering Experimental Laboratory, Kyoto University, Sakyo, Kyoto 606-8501, Japan b Collaborative Research Center for Cluster Ion ... The intensity of neutral cluster beam increased with source gas pressure. ... The beam current increased with source gas pressure. ...

Еще в разделе: (Показать все результаты (>86) - danp.sinp.msu.ru/ )

• SECTION 1 Title 1 Title 2 Title 3

О ВОЗМОЖНОСТИ ОПИСАНИЯ ТУРБУЛЕНТНОСТИ, КАК СТОХАСТИЧЕСКОГО ПРОЦЕССА, БЕЗ ИСПОЛЬЗОВАНИЯ ДРОБНЫХ ДИФФЕРЕНЦИАЛОВ ПО ВРЕМЕНИ. ... Существующие способы описания стохастических процессов с помощью дифференциальных уравнений можно разделить на три основных класса. ... Все это затрудняет использование стохастических дифференциальных уравнений при описании стохастических процессов. ... Предложены дискретные аналоги таких систем уравнений. ...

Еще в разделе: (Показать все результаты (>55) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2010/Programm_2010-3.files/sheet007.htm
• http://hit-conf.imec.msu.ru/2012/abstracts/Kolmychkov.doc
• NeZaTeGiUs

... 101, No. 4, 2005, pp. ... 128, No. 4, 2005, pp. ... NUCLEI, PARTICLES, FIELDS, GRAVITATION, AND ASTROPHYSICS Analysis of Small-Scale Wave Structures in the Saturnian A Ring Based on Data from the Cassini Interplanetary Spacecraft E. B. Postnikova and A. Yu. ... The method of analysis is based on the original algorithm of a continuous wavelet transform with a complex Morlet wavelet that reduces the integral transform to solving a Cauchy problem for a system of partial differential equations. ...

Еще в разделе: (Показать все результаты (>51) - chaos.phys.msu.ru/ )

... Студенту и аспиранту . ... Правила проведения зимней экзаменационной сессии на геологическом факультете МГУ . ... Объем курса - 96 часов, лекции - 36 часов, лабораторные занятия - 60 часов. ... Вторая часть преподается студентам после их распределения по кафедрам различной специализации. Программы этой части формируются на кафедрах и учитывают особенности использования математического аппарата при решении задач обработки данных применительно к специальным объектам исследования. ... Решение задач. ...

Еще в разделе: (Показать все результаты (>47) - geol.msu.ru/ )

... Кафедра математики . физического факультета МГУ . ... Дифференциальные уравнения . ... Математический анализ 2 . ... Абстрактные дифференциальные уравнения с приложениями в математической физике . ... Семинар кафедры . ... 13 апреля 2016 г. Заседание кафедры 15.30, ауд. ... Коллоквиум по курсу "Основы математического моделирования" 1 поток: 6 (письм.) и 9 (устн.) апреля; 2 поток: 12 (письм.) и 15 (устн.) апреля . ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова 2014-2016 гг. ...

Еще в разделе: (Показать все результаты (>3) - math.phys.msu.ru/ )

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

78. Учебные курсы - Палеоманитология

79. Кафедра физики Земли Физического Факультета Московского Государственного

80. http://dfgm.math.msu.su/files/koudr/publ.pdf