... Parent Directory - _vti_cnf/ 24-Oct-2012 02:50 - filelist.xml 08-Dec-2003 16:18 476 image001.gif 08-Dec-2003 16:18 5.3K image002.wmz 08-Dec-2003 16:18 427 image003.gif 08-Dec-2003 16:18 393 image004.wmz 08-Dec-2003 16:18 469 image005.gif 08-Dec-2003 16:18 537 image006.wmz 08-Dec-2003 16:18 374 image007.gif 08-Dec-2003 16:18 245 image008.wmz 08-Dec-2003 16:18 454 image009.gif 08-Dec-2003 16:18 521 image010.wmz 08-Dec-2003 16:18 391 image011.gif 08-Dec-2003 16:18 338 . ...

Еще в разделе: (Показать все результаты (>197) - genphys.phys.msu.su/ )

• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files/_vti_cnf

... Fursikov Andrei Vladimirovich . Head of the Department . ... Navier-Stockes equations, statistical hydrodynamics, theory of control for systems with distributed parameters. student of Mark Iosifovich Vishik . ... He is a member of the editorial board of "Journal of Dynamical and Control Systems", "Journal of Mathematical Fluid Mechanics", "Interdisciplinary Math. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>138) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Gorshkov Aleksey Vyacheslavovich | Department: General Problems of Control.
• Seminars of the department | Department: General Problems of Control. Faculty

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>7) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>173) - imaging.cmc.msu.ru/ )

• Ringing analysis - database | Laboratory of Mathematical Methods of Image
• Research | Laboratory of Mathematical Methods of Image Processing

INTERNET TECHNOLOGIES AND NEW CONCEPTION OF WDCs SYSTEM P.Yu.Pletchov, (Computer Center, RAS, Moscow, Russia, E-mail: lym@ccas.ru) Yu.S.Tyupkin (National Geophysical Committee of Russia Federation and Geophysical Center of RAS, Moscow, Russia, E-mail: tyupkin@wdcb.rssi.ru) In this technical report we wish to discuss the problem of setting up the distributed information system as a part of new conception of World Data Centers system. ... 4) Editing descriptions of an information resource by user. ...

Еще в разделе: (Показать все результаты (>558) - geo.web.ru/ )

• http://geo.web.ru/~ariskin/soft.html-id=inforex.htm
• http://geo.web.ru/conf/alkaline/2009/Woolley.htm
• Spectrum of Heterogeneity

... Nonlinear Standing Waves in an Acoustical Resonator with the Longitudinal Mean Temperature Distribution . ... This paper deals with the problem of nonlinear standing waves in the axisymmetrically shaped acoustic resonators where a mean temperature is distributed along their axis. ... The one-dimensional model equation for nonlinear standing waves of the 2-nd order including a viscous boundary layer is modified to take into account a longitudinal distribution of mean temperature. ...

Еще в разделе: (Показать все результаты (>173) - acs366.phys.msu.su/ )

.

Еще в разделе: (Показать все результаты (>35) - hep.msu.dubna.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . Журнал PC World обнародовал список победителей ежегодного конкурса World Class Awards - свою собственную версию рейтинга "100 лучших продуктов 2005 года". ... Zone Labs ZoneAlarm Antivirus Antivirus and Firewall Software . ... Moon Software Password Agent Password Manager . ... Winternals Software ERD Commander Data Recovery Software . ... Tor Privacy Software . ... Sunbelt Software CounterSpy Anti-Spyware Software . ...

Еще в разделе: (Показать все результаты (>493) - www.moscowuniversityclub.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Embedded firebird database - вопрос по скорости . ... Написал программу, работающую с Embedded Fireberd. ... Re: Embedded firebird database - вопрос по скорости [ re: zabeyka ] ....

Еще в разделе: (Показать все результаты (>4520) - www.snto-msu.net/ )

• [linux] stardict and utf8 problem - Public forum of MSU united student networks
• Oracle без лицензии работает? - Public forum of MSU united student networks
• [News] Научное программное обеспечение - Public forum of MSU united student

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>68) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

... It means that if protein-protein interaction data is known than it is possible to reconstruct binding sites on DNA. ... In order to check this many approaches using binding sites predictions for different transcription factors were applied. ... Also ChIP-seq data was used from several sources. ... Neighboring predicted binding sites and number of Intersections between ChIP-seq regions were searched and protein-protein interaction data was taken into account. ...

Еще в разделе: (Показать все результаты (>245) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/104.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/149.pdf

Your browser is unable to view this page!

Еще в разделе: (Показать все результаты (>2) - languedoc.philol.msu.ru/ )

International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...

Еще в разделе: (Показать все результаты (>705) - ilc.phys.msu.ru/ )

• IV International Symposium Modern Problems of Laser Physics MPLP'2004
• Grant detail
• Laboratory of theoretical problems in optics

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>18) - ecoinformatica.srcc.msu.ru/ )

... Next: Scan windows Up: Server's main window Previous: Instrument panel Contents Index . In Events message window information on current microscope status can be seen. All messages are stored in file with next filename format fmbDDMMYY.log ( DDMMYY - current date, month and year) in the directory where fmboard.exe file is stored. ... Log file for this window named fmberr.log stored in the same directory. Every error message is accompanied with sound signal. ...

Еще в разделе: (Показать все результаты (>144) - www.spm.genebee.msu.ru/ )

• FemtoScan Online FAQs
• Slide Show
• Files Quick Viewing

Выпускники 1968 . ... Список выпускников . Этот список мы не контролируем . ... список не полный . ... Список выпускников из зарубежья . ... Web - ...

Еще в разделе: (Показать все результаты (>38) - foroff.phys.msu.ru/ )

• Глубокоуважаемые коллеги

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>77) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Theory of resistivity sounding
• Researchs

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• Rikho Nymmik

. This Page Requires JavaScript 1.1 . Your browser either does not support JavaScript, or it has JavaScript support disabled. If you want to correctly view this page, please upgrade your browser or enable JavaScript support.