SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . Run Time: 0.000535 . Select Type . ... Type . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>26) - osk.msu.ru/ )

• http://osk.msu.ru/forum/forums/faq.8/?_debug=1
• http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1
• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

Pipe Line Filtering Dmitry V. Yurin Moscow State University, Faculty of Computational Mathematics and Cybernetics, Lab. of Mathematical Methods of Image Processing. yurin_d@inbox.ru Abstract A unified template C++ library is proposed for image filtering by local environment. ... It makes easy to combine filters and transfer output of filters to input of others. ... Otherwise, each filter one time should process input and output lines with the same relative numbers in the images. ...

Еще в разделе: (Показать все результаты (>818) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_kravtsov.scripting.en.pdf
• View publication | Laboratory of Mathematical Methods of Image Processing
• Publications | Laboratory of Mathematical Methods of Image Processing

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>30) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => NSR Search Engine

SURNAMES OF THE ASTRONOMERS IN THE NAMES OF THE LUNAR OBJECTS. ... Sternberg State Astronomical Institute, Moscow University, Moscow, Russia The whole complex information about toponymy, morphology, selenographical coordinates and dimensions of the lunar objects was included in the automated information system for the Lunar Nomenclature. ... You may receive more detailed information in the Russian version of this article (nomen.pdf). ...

Еще в разделе: (Показать все результаты (>116) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Ber/Publications/ms40/09_Berezhnoy_etal.pdf
• http://selena.sai.msu.ru/Pug/Publications/Pugacheva%20LPS%2041.pdf
• http://selena.sai.msu.ru/Bus/Publications/ms34/MS012.pdf

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>267) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• Screening by similarity
• Genebee Predicted Annotation - Advanced

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>61) - erg.biophys.msu.ru/ )

• PyMol script for scanning potential energy surfaces ERG Research Group:
• Using RESP with GAMESS-US and Firefly (PC-GAMESS) ERG Research Group:
• Nanotubes generating script for PyMol ERG Research Group: Лаборатория

... References [1] V.A. Il'in, E.I. Moiseev, Dokladi Akademii Nauk, v. 411, No. 6, 736-740 (2006). (in Russian). 2] V.A. Il'in, E.I. Moiseev, Dokladi Akademii Nauk, v. 417, No. 1, 12-17 (2007). (in Russian). 3] V.A. Il'in, E.I. Moiseev, Dokladi Akademii Nauk, v. 417, No. 2, 160-166 (2007). (in Russian). ... 6] V.A. Il'in, E.I. Moiseev, Differensial'nie Uravnenia, v. 42, No. 11, 1558-1570 (2006). (in Russian). ...

Еще в разделе: (Показать все результаты (>60) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/VasilievaButuzovNefedov.pdf

... The exercises cover the following areas: Session A covers three ways you can use ROOT: the command line, the script processor, and the graphical user interface (GUI). ... Session A: | ... Display |cern.ch/root/Atlfast.html| ... Use the ROOT command line . ... In a new session open the new ROOT file (altfast.root) and find the TFile method to print the compression factor: root[] TFile f("atlfast.root") root[] f.<TAB> 3: What is the size and compression factor of the generated file, atlfast.root? ...

Еще в разделе: (Показать все результаты (>68) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/brun/Solutions_2.doc
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-08-Information1.pdf
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc

... Physical Geography and Landscape Science . ... Departments . ... Journal "MSU Vestnik", series "Geography" . ... S.A. Dobrolubov, doctor of science, corresponding member of the Russian Academy of Sciences, professor (Deputy Editor-in-chief) http://istina.msu.ru/profile/dobroscience/ . ... V.V. Yanko-Khombach, doctor of science, professor (Avalon Institute of Applied Sciences, Winnipeg, Canada) http://www.avalon-institute.org/;http://onu.edu.ua/ru/structure/faculty/ggf/geo_sea/staff/yanko . ...

Еще в разделе: (Показать все результаты (>109) - eng.geogr.msu.ru/ )

• Newsletter «RUSSIAN SUSTAINABILITY NewsLETTER»

... Interaction classes . ... List of Contact Types: . ... Contact with Major Groove of DNA by helices, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by strands, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by helices, loops . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by loops . ...

Еще в разделе: (Показать все результаты (>18) - npidb.belozersky.msu.ru/ )

• NPIDB: Families of interaction class
• NPIDB: Home
• NPIDB: About Us

... However, unlike the situation with some other general psychological problems (for example, such issues as the structural-functional organization of the mental-processes system, the structural organization of personality, the structural level of activities), the systems approach seems to be insufficiently implemented in relation to ability problems. ... It follows that the integral abilities are at the same time both a system of mental functions and activity entities. ...

Еще в разделе: (Показать все результаты (>183) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013-2/veraksa_pr_2013_2.pdf
• http://www.psy.msu.ru/science/psyrussia/2012/shelina.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/sergienko.pdf

... By default title search by inclusion of any word in list. Whole phrase' search allow you to enter title inaccurate (MySQL SOUNDEX algorithm). Title . Whole frase Contain ALL words Whole words . ... Whole phrase By ID [add ID] . Category . add category] . Data access control . ... Data type . ... AND for data type [ If not checked, OR predicate use for 'Data type'. If no of checkboxes were checked 'Data type' is excluded from search. ...

Еще в разделе: (Показать все результаты (>436) - journals.genebee.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>11) - hsmi.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>138) - bioinf.fbb.msu.ru/ )

... Ribonuclease H-like motif . ... Ribonuclease H-like . ... Ribonuclease H . protein domain . ... HIV RNase H (Domain of reverse transcriptase) . Human immunodeficiency virus type 1 [TaxId: 11676] . ... BH0863-like Ribonuclease H . Bacillus halodurans [TaxId: 86665] . ...

Еще в разделе: (Показать все результаты (>6442) - monkey.belozersky.msu.ru/ )

Home Page Top ology on Graphs Title Page Contents Zhi Lu Ё Institute of Mathematics, Fudan University, Shanghai. Page 1 of 22 Osaka, 2006 Go Back Full Screen Close Quit Home Page §1. ... Title Page Contents Page 15 of 22 Go Back Full Screen Close Quit Home Page Basic problem (I) (, ): a coloring graph of type (n, n) with connected. ... Title Page Contents Page 20 of 22 Go Back Full Screen Close Quit Home Page Prop osition. ... Title Page Contents Page 22 of 22 Go Back Full Screen Close Quit ...

Еще в разделе: (Показать все результаты (>217) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/UchProcess-2015-16/Programm-DifferentialTopology.pdf
• S.P.Novikov Seminar
• Publications (English)

Using GibbsLib.dll in user's applications Contents Introduction 2 Creating and deleting the object Gibbs 2 Gibbs object properties 3 Common Gibbs properties 3 Special Gibbs properties 4 Gibbs object methods 6 Common Gibbs methods 6 CallGibbs 6 ReCallGibbs 7 SetFugacities 8 CancelGibbs 9 ShutDown 9 Special ... mode option) of i-th species: | ... If used, this property must be set before SystemFile, as some options affect the way System files are read (see "Gibbs options" below). ...

Еще в разделе: (Показать все результаты (>97) - www.geol.msu.ru/ )

• Известия Секции Наук о Земле Российской Академии Естественных Наук
• Department of Lithology and Marine Geology - Laboratories

. Welcome . Chronicles . Faculty today . Structure . Research . Collaboration . Admission . Useful Info . Academic Calendar . Grading System . Russian Language . Tuiton Structure . Postdoc . Fees . Contacts . Graduates !!! . Traditions . Campus Map . Faculty . Photogallery

Еще в разделе: (Показать все результаты (>51) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)