Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>15) - astrometric.sai.msu.ru/ )

• Encyclopedia

GSK-3 Inhibitors: The Dataset . ... We suppose that it will be useful for the other researchers in the field of chemoinformatics; the main peculiarity of this Dataset is wide activity range of compounds and significant diversity of the actives (true inhibitors). ... IC50 is given in nM (sic!) according to the data reported in the article. It's a text field (as well as the other raw activity data fields) and values like '>10000' are given for inactive compounds. ...

Еще в разделе: (Показать все результаты (>5) - qsar.chem.msu.ru/ )

Emb edding formulae for diffraction by wedge and angular geometries B y R. V. Craster1 A. V. Shanin 1 2 2 Department of Mathematics, Imperial Col lege of Science, Technology ... London SW7 2BZ, U.K. Department of Physics (Acoustics Division), Moscow State University, 119992, Leninskie Gory, Moscow, Russia Embedding is the process of taking the far field directivity from a diffraction problem (or problems) involving line sources or multipoles placed at a sharp ... The Wedge, pp. ...

Еще в разделе: (Показать все результаты (>50) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/pseudodif.pdf
• http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf

... The name IE2DP1 means: Integral Equation (method of decision), 2D (dimension), P (point current electrodes), 1 - across inhomogeneities. IE2DP1 program fulfills two dimensional (2D) electric field modeling for different modifications of resistivity and induced polarization (IP) field techniques. ... Apparent chargeability is saved always in the file "IE2DP1.RES" and reference point is in current electrode location. ... Number of angular points for one body more than 40 5. ... Run file "start.bat". ...

Еще в разделе: (Показать все результаты (>63) - geophys.geol.msu.ru/ )

• TES. Base model
• TES tecnology. MSU.
• TES. Conclusion

... Based on the concept of -matrix and Choi­Jamiolkowski states we develop the approach of quantum process reconstruction. ... The approach is tested with the statistical reconstruction of the polarization transformations in anisotropic and dispersive media realized by means of quartz plates and taking into account the spectral structure of input polarization states. ... Knowing the input and measured (output) states, one can reconstruct the -matrix of the quantum process. ... Mixed state...

Еще в разделе: (Показать все результаты (>95) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2013-njp-15-073016.pdf
• http://qi.phys.msu.su/papers/2007-jetp(e)-104-30.pdf
• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf

Adler map for Darboux q -chain Sergey V. Smirnov Moscow State University 1 Continuous case Spectral problem + ( - u) = 0 for one-dimensional SchrЁ odinger operator can be rewritten in matrix form = U , where = , U= 0 1 u- 0 . In their joint work [1], Veselov and Shabat considered the dressing chain for SchrЁ odinger operator, that is, the sequence of second order differential operators Lj on the real line satisfying the following operator relation: Lj = Aj A+ - j = A+ 1 Aj -1 . ...

Еще в разделе: (Показать все результаты (>333) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf
• http://higeom.math.msu.su/course_papers/lim4.pdf
• http://higeom.math.msu.su/people/taras/mypapers/jms-03.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... Leading Researcher . Senior Researcher . ... Research Associate . 7(495)939-4372 (4) . ... The Laboratory performs research activity in the following directions: . Quantum optics of biphoton fields . Quantum optics of pulsed fields . ... Terahertz generation and detection . ... Quantum photometry in the terahertz range . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>2) - quantum.phys.msu.ru/ )

• About us | Department of Quantum Electronics

Лабораторная система отсчета . Laboratory coordinate (or reference) system . ... Левая система . Left-handed system . Left-hand system . Левая система координат . Left-handed coordinate system . Left-handed system of coordinates . ... Left triangular matrix . ... Ленточная матрица . Band matrix . ... This subroutine solves a symmetric positive definite banded system of linear equations . ... Ship of the line . ... Линия (пунктирная, штриховая, волнистая, сплошная) . ...

Еще в разделе: (Показать все результаты (>203) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/list_wrk/ps1/ch2st2.ps
• http://num-anal.srcc.msu.su/eng_math/redict/14.htm

... Faculty of Physics . ... Research Centers . ... Second harmonic generation in metamaterials with magnetodipole resonance . ... In the research performed by collaboration of scientists from Laboratoire d'Optique Appliqu?e (France), Centro Ricerche Frascati (Italy), and Faculty of Physics of M.V. Lomonosov Moscow State University was for the first time made the detailed experimental study of completely isolated low-order harmonics obtained with interferential filtering from the wide harmonic spectrum....

Еще в разделе: (Показать все результаты (>157) - phys.msu.ru/ )

• SAMSUNG EDUCATIONAL PROGRAMS

BNL PREPRINT BNL­QGS­98­0501 Study of Ї pp Baryon Exchange Processes V. L. Korotkikh 1;2 June 25, 1998 abstract The cross­section of the process Ї p + p ! ... ъ + + ъ \Gamma We repeated Barger and Cline's [3] calculation of reaction (3) and received the same 2 results at 10 GeV with their parameters: fi \Delta 8ъ = 0:10 GeV \Gamma1 ; s 0 = 2:85 GeV 2 ; ff \Delta (u) = 0:15 + 0:9 u: (5) The differential cross­section depends on these parameters as dЇoe du = 389:3 Їb ъ 2 s / fi \Delta 8ъ ! ...

Еще в разделе: (Показать все результаты (>50) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/etaetapi_1.5.pdf
• http://lav01.sinp.msu.ru/nir/papers/NIM_Cyl-Drift-Ch.pdf
• http://lav01.sinp.msu.ru/~vlk/g276799p10_proof.pdf

TITLE OF THE ABSTRACT FIRST I. AUTHOR1, SECOND I.J. AUTHOR2 AND THIRD AUTHOR2 1Organization name of the first author first_ author@email.ru 2Organization name of the second and third authors second.author@email.com, third_author@mail.eu Key words: list up to eight words or group of words in order of priority, separated by commas. ... The abstract including figures, tables and reference should not exceed 1 page. The title should be centered in the page, in 11pt, boldface Roman, all capital letters. ...

Еще в разделе: (Показать все результаты (>26) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf
• http://hit-conf.imec.msu.ru/2006/CD/PetrovaLI.doc
• http://hit-conf.imec.msu.ru/2006/Template.doc

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>24) - beams.chem.msu.ru/ )

... Science . ... lrm@cs.msu.su . ... The Laboratory of Difference Methods was founded by A.A.Samarsky, Academician of RAS, in the middle of the 60s. For more than 50 years the Laboratory?s theoretical research has been focused on numerical methods for problems described by systems of partial differential equations. ... N.V.Ardelyan, V.L.Bychkov, I.V.Kochetov and K.V.Kosmachevskii, Non-self-maintained discharge plasma in propane-air mixture // IEEE Trans. on Plasma Science, vol. 39. no. 12, part 1, pp. ...

Еще в разделе: (Показать все результаты (>127) - en.cs.msu.ru/ )

• Laboratory of Difference Methods
• Department of Mathematical Physics | CMC MSU
• Open Laboratory of Information Technologies | CMC MSU

. [ Войти ] . Главная -> Фильмы -> Following the Rabbit-Proof F.. Пользователи . Демо . Деньги . Фильмы . Форум . Following the Rabbit-Proof Fence . Австралия 2002 . отметить . Документальный . Комедия . Драма .

Еще в разделе: (Показать все результаты (>223) - kinfo.ru/ )

• Just Follow Law: Wo zai zhen.. - Фильмы - Kinfo.ru
• Follow the Prophet - Фильмы - Kinfo.ru
• Follow Me, Boys! - Фильмы - Kinfo.ru

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• Pressure Distribution Peculiariry Along Square Canopy
• On Square Parachute Differential Equations
• Scientific Achievements

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>124) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/785/2468.pdf
• http://ics.org.ru/upload/iblock/a49/RCD716.pdf
• http://ics.org.ru/upload/iblock/970/119-some-comments-to-the-paper-by-a-m-perelomov-quot-a-note-on-geodesics-on-ellipsoid-quot-rcd-2000-5-1-_ru.pdf

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>20) - dynamo.geol.msu.ru/ )

• V.Zakharov's Ph.D. thesis
• Summaries of articles

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>12) - psyberlink.flogiston.ru/ )