... Opto-Acoustic Response From Absorbed Particle in Liquid . ... This work is devoted to a theoretical analysis of the opto-acoustic effect in an inhomogeneous medium consisting of an absorbing spherical particle in an immersion (nonabsorbing) liquid irradiated with laser pulses. ... In the case of a thermally small particle, a heating of a particle takes place uniformly at its volume and the opto-acoustic pulse is excited only by thermal expansion of immersed layer of liquid. ...

Еще в разделе: (Показать все результаты (>100) - acs366.phys.msu.su/ )

• Schedule : General Theory, Mathematics, Numerical Methods of Nonlinear...
• Schedule : Nonlinear Acoustics of Fluids and Multi-Phase Media, Cavitation

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>63) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

Fast direct large-scale MCSCF code for Segmented and General Contraction Basis Sets Alexander A. Granovsky Laboratory of Chemical Cybernetics, M.V. Lomonosov Moscow State University, Moscow, Russia September 14, 2005 Large-scale MCSCF Main steps of MCSCF iteration ( unfolded two step type) Integral transformation CI problem DM1 DM2 calculation ... Alternative approach: (pq|) ... Reminiscence: Fock Matrix F2(D) = J(D) - K(D) J = (|) ...

Еще в разделе: (Показать все результаты (>51) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - FAST MATRIX DIAGONALIZATION AND INVERSION
• Firefly/PC GAMESS DOCUMENTATION - LARGE SCALE CI, MCSCF, and QDPT2
• PC GAMESS/Firefly sample input file - relaxed surface scan in DLCs

... OpenMP. ... lastprivate lastprivate , private. , work-sharing . ... pragma omp parallel default(private) shared shared . ... setenv OMP _SCHEDULE guided,4 #include omp .h #define CHUNK #define N main () { 10 100 int nthreads, tid , i, n, chunk ; float a[N], b[N], c[N]; for (i=0; i N; i++) a[i] = b[i] = i * 1.0; n = N; chunk = CHUNK ; # pragma omp parallel shared (a,b,c,n, chunk ) \ private (i,nthreads, tid ) { tid = omp _get_thread_num(); # pragma omp for schedule(dynamic...

Еще в разделе: (Показать все результаты (>3) - angel.cmc.msu.ru/ )

: «SAP HANA ­ the main memory database platform for modern hardware» «SAP HANA ­ » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ­ , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... NH2 2, O2 P2 . ... Arg114 . ... Arg 3 . ... 100% . ... NH2 2, O1P2 . 2.89 . ... ND2 2, O1P2 . ... NZ 2, O1P2 . ... G1291 . OD1 2, O1P2 . ... Arg 102 . ... Arg 119 . ...

Еще в разделе: (Показать все результаты (>9) - rnp-group.genebee.msu.ru/ )

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>48) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Compiling Apache under UnixWare
• Apache Tutorials

announces . seminars & conferences . Zelmanov' seminar . scientific & engineering staff . students & postgraduates . useful links . projects . articles . catalogs & databases . algorithms & programming . 1 mas (отчет о первой астрометрической школе) . Труды ГАИШ . history of Moscow astronomical observatory . photo gallery . miscellaneous . Some pages are now in Russian only. editor valera , . librarian gribko .

Еще в разделе: (Показать все результаты (>14) - astrometric.sai.msu.ru/ )

... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...

Еще в разделе: (Показать все результаты (>108) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/4-2wireshark.pdf

Microsymposium 38, MS080, 2003 (A4 format) PHYSICAL AND MINERALOGY CHARACTERISTICS OF THE LUNAR REGOLITH IN THE AREAS OF THE THERMAL ANOMALIES. ... Comparison of the local cumulative number of particles N per 104 m2 and photometric roughness parameter I. In this report we research data of the IR thermal radiation, the rough structure of the lunar regolith and mineralogy characteristics upper layer of the surface. ... The spatial graphical function of the lunar-surface thermal radiation. ... Figure 3. ...

Еще в разделе: (Показать все результаты (>74) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Laz/Publications/5_THE%20LUNAR%20SUBPOLAR%20RELIEF%20MAP%20THE%20WAYS%20AND%20TECHNIQUES%20OF%20COM.pdf
• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf
• http://selena.sai.msu.ru/Laz/Publications/4_RASTER%20VENUS%20AND%20LUNAR%20MAPS%20AS%20A%20SOURCE%20FOR%20OBTAINING%20VECTOR%20TOPOGRAPHIC%20DATA.pdf

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

• Master program "Network Software" | Магистерское и послевузовское образование

... News . ... Main activities of the group relate to the nanophotonics and nano-optics of different types of nanostructures including metamaterials. ... Optical tweezers allow the manipulation and measuring the interaction forces of microscopic objects from single living cells to magnetic micro-particles in magnetic fluids. ... Submitted by Маруся_П on Wed, 03/09/2016 - 16:07 . ... Submitted by Маруся_П on Fri, 02/19/2016 - 15:02 . ... Submitted by Маруся_П on Thu, 02/18/2016 - 17:25 . ...

Еще в разделе: (Показать все результаты (>83) - nanolab.phys.msu.ru/ )

• Optical tweezers and photonic force microscopy | Laboratory of Nanophotonics &
• Nanophotonics of surface states in photonic crystals | Laboratory of

. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address

76. JCatalog - Science Magazines Catalog

77. Contact information | Department of the Automation for Scientific Research CMC

78. K-corrections calculator

79. http://www.inpro.msu.ru/files/do/Minyailov.files/outline.htm

80. http://site2010.sai.msu.ru/static/doc/VOrlov_site2010.pdf