... Detailed design . ... 5 Message passing tools, independent from base system of message passing . ... 7 Tracing user program and Run-Time System . ... 7.2.5 Controlling internal self-checking Run-Time System mechanisms, functioning during trace accumulation . 7.2.6 Controlling output of additional information when tracing some Run-Time System functions in extended mode . ... 8 Output of informational messages of Run-Time System and error messages . ... Lib-DVM - detailed design (contents) . ...

Еще в разделе: (Показать все результаты (>75) - sp.cs.msu.ru/ )

• Debugging DVM-program performance. User's guide

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

ALL: visual_statistics.pdf %.pdf: %.tex Makefile lualatex --enable-write18 $ \|^+ \|^%> " visual_statistics.tex | sed -e "s/^\\\/\n# \\\/g" | sed -e "s/^%*> /\n/g" | sed -e "s/^+ //g" > visual_statistics.r plots: pdflatex rrefc_en.tex R CMD Sweave test-Sweave.Rnw pdflatex test-Sweave.tex mv -f test-Sweave.pdf pics/ Rscript visual_statistics.r output: Rscript -e 'source("visual_statistics.r", echo=T)' > visual_statistics.txt

Еще в разделе: (Показать все результаты (>187) - herba.msu.ru/ )

• Index of /shipunov/school/biol_240/en
• The employment of quantitative methods for the lake ecosystem research
• Flora of lakes in Chupa gulf environs

Poster session will take place on July, 21st, 16:00 till 18:00, in the building of Biological Faculty of the MSU (no.8 on the map ). ... BBA . ... Protein structure . ... Homology Modeling and Comparative Analysis of Serotonin 5-HT3 Receptor Structure in Native and Modified Forms . ... Protein families . ... GTF2I domain: structure, evolution and function . ... Evolution, phylogeny, taxonomy . ... Genomics . ... An evolutionary space for microbial evolution and community structure analysis . ...

Еще в разделе: (Показать все результаты (>267) - mccmb.belozersky.msu.ru/ )

• MCCMB'15

News . News Archive . ... SUNY @ Albany Delegation from the Department of Mathematics and Statistics headed by the Dean E. Turner including prof. B. Goldfarb and prof. K. Zhu. ... Do not leave without exploring our News Archive . ... suny-msu . ...

Еще в разделе: (Показать все результаты (>27) - suny.msu.ru/ )

... education . ... MSU Nanotechnology Education and Research Center (ERC) was established in 2008 to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... MSU Nanotechnology Education and Research Center invites all to attend the cross-disciplinary lecture series ? ... XIII конференция студентов и аспирантов Научно-образовательного Центра по физике и химии полимеров 29 ноября 2013 года . ...

Еще в разделе: (Показать все результаты (>25) - nano.msu.ru/ )

• Composite Nanomaterials Educational Program | MSU Nanotechnology Education and

The Status Module is only available in Apache 1.1 and later. The Status module allows a server administrator to find out how well their server is performing. ... The number of children serving requests . ... The status of each child, the number of requests that child has performed and the total number of bytes served by the child (*) . ... Module: mod_status . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>130) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QIntCache member list
• Qt Toolkit - QPtrDict member list
• Qt Toolkit - QGCache member list

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>53) - talant.msu.ru/ )

• Closeout of the educational project ?Literary Evenings? | The Department of
• III Championship in an innovative educational project Cansat in Russia | The
• International Student Olympiad in Iran | The Department of Talented Youth

... 1.1. ... Animal Behaviour» «Plenum». ... Animal Behaviour, Japanese Journal of Clinical Oncology, Australian Veterinary Journal, Journal of Veterinary Internal Medicine. . ... Guidelines for the treatment of animals in behavioural research and teaching», «Animal Behaviour» ( 2003 .: ... p - , n - , 120 100 80 60 40 20 p < 0,05 n = 25 0 n = 32 25%-75% Min-Max . ... 1990), ...». , (: , , 1990); « .» ( ­ «et al.» ... Fogg, 1965; , 1977; , , 1987). , , : - (1979, 19796, 1979) - (1979, 1979b, 1979). ...

Еще в разделе: (Показать все результаты (>11) - plantphys.bio.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... Inverse problems in mathematical physics . ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>4) - dubrovinlab.msu.ru/ )

... Inga F. Dolmanova , Associate Professor, Ph.D. - head of the laboratory . ... 7-(095)-939 46 75 . ... Laboratory research is devoted to kinetic methods of analysis in their catalytic variant. We develop methods for determination of inorganic and organic catalysts and enzymes and of those compounds which affect the catalytic activity of catalysts (inhibitors and activators). ... Sensitive, selective, simple and rapid enzymatic methods for determination of enzyme effectors are developed. ...

Еще в разделе: (Показать все результаты (>687) - chem.msu.ru/ )

• Laboratory of Chromatographic Methods of Analysis
• Laboratory of spectroscopy methods of analysis
• Selected chapters of chemistry: modern methods of investigation and analysis

... Performance System Analysis . ... X-COM: Distributed Computing Software . ... The toolkit of this type is being developed in the Laboratory of Parallel Informational Technologies of Research Computing Center of Lomonosov Moscow State University. ... Complex performance system analysis is nowadays one of the major research trends aimed at securing efficient HPC resources utilization of MSU and other supercomputer centers. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• HOPSA - the joint RF/EU project: HOlistic Performance System Analysis | Moscow
• TOP50 RATING: THE MOST POWERFUL SUPERCOMPUTERS OF CIS | Moscow University
• INTRODUCTION | Moscow University Supercomputing Center

Determination analysis as a method for diagnostics of ecosystem condition . ... It is capable effectively to work with variables which distribution is not normal, and also with qualitative variables, it is not sensitive to availability of zero values in arrays of data. ... With the help of DA the solving of problem of ecological standardization is possible, i.e. determination of ranges of environmental factors values at which condition of different parts of biota is ecologically satisfactory. ...

Еще в разделе: (Показать все результаты (>533) - chronos.msu.ru/ )

• Laboratory-chair of causal mechanics

... Field of interest: data analysis and interpretation of X-ray observations of BHC and NS systems, astrophysics of compact objects and related phenomena: X-ray , optical and radio observations , shocks and stellar winds, emission mechanism, the spectral and timing analysis of the X-ray emission from microquasars ( signature of accreting BH), atoll- and Z-sources ( signature of accreting NS), modeling of INTEGRAL images % . ...

Еще в разделе: (Показать все результаты (>13) - uranus.sai.msu.ru/ )

• The Database of Close Binary Systems