... The frequency dependence of the hopping conductivity of dense arrays of semiconductor quantum dots of size a substantially exceeding the edge-to-edge separation w between neighboring quantum dots is considered. It is shown that at low frequencies in a wide frequency range the conductivity obeys a fractional power law and its magnitude depends on the structural characteristics of the material. ...

Еще в разделе: (Показать все результаты (>64) - scon155.phys.msu.su/ )

• Universal theoretical description of electronic transport in disordered organic
• First-principles calculations of physical properties of crystals

Renat Nazmutdinov (Kazan N Res Techn U) Q:Why non-Gaussian fluctuations appear, how can we explain them? A: Q: What should be the conditions to observe high tunneling factor? [it was not completely clear written, sorry] A:

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

Approximation of Abstract Differential Equations . ... This review paper is devoted to the numerical analysis of abstract differential equations in Banach spaces. Most of the finite difference, finite element, and projection methods can be considered from the point of view of general approximation schemes. ... The qualitative theory of differential equations in Banach spaces is presented in many brilliant papers and books. ...

Еще в разделе: (Показать все результаты (>125) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... The Geostatistical Software Tool is the leading block modeling software in Russia . ... The source data, block models, solids and surfaces are importable/exportable. Block models may hold any quantity of properties. ... Variogram model, trend model, data transform model, declusterisation model, parameters of the search ellipsoid, lriging type, kriging strategy – are considered not as separate things, but as parts of the complete variability model , that is managed from one point. ...

Еще в разделе: (Показать все результаты (>439) - geo.web.ru/ )

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Еще в разделе: (Показать все результаты (>111) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.Graphicon.Nasonov_Krylov.Metrics.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• http://imaging.cs.msu.ru/pub/2009.Graphicon.Nasonov_Krylov.Ringing.en.pdf

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>46) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf
• http://dfgm.math.msu.su/files/ivanov-tuzhilin/Lecture_Notes.pdf

Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...

Еще в разделе: (Показать все результаты (>22) - lomonosov.sinp.msu.ru/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>169) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal

DAYS on DIFFRACTION 2013 1 Giant Second-Harmonic Generation Enhancement in the Presence of Tamm Plasmon-Polariton Afinogenov B. I., Bessonov V. O., Fedyanin A. A. Faculty of Physics, Lomonosov Moscow ... 119991, Russia e-mail: fedyanin@nanolab.phys.msu.ru Tamm plasmon polariton (TPP) is an optical analogue of an electronic density localization at the boundary of periodic atomic potential and appears as electromagnetic field ... Spectrum for ps combination is multiplied by the factor of 20. ...

Еще в разделе: (Показать все результаты (>75) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/dd15_shilkin.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jetplett91_382_2010.pdf

... Войти в систему . ... Toshchakov S.V. , Korzhenkov A.A. , Samarov N.I. , Mazunin I.O. , Mozhey O.I. , Shmyr I.S. , Derbikova K.S. , Taranov E.A. , Dominova I.N. , Bonch-Osmolovskaya E.A. , Patrushev M.V., Podosokorskaya O.A. , Kublanov I.V. в журнале Standards in genomic sciences , издательство Michigan State University and the Genomic Standards Consortium (East Lansing, MI, United States) , том 10, ? ...

Еще в разделе: (Показать все результаты (>2299) - istina.msu.ru/ )

• James D. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• SPE Drilling and Completion - журнал | ИСТИНА - Интеллектуальная Система
• Russian Journal of Marine Biology - журнал | ИСТИНА - Интеллектуальная Система

... Consequently, weak fluctuations of the 1 growth rate concerning the M growth rate must necessarily generate strong fluctuations of the 2 growth rate. ... Statistics show that financial shocks occurred at positive values of ()(GDP). ... To test our hypothesis we consider correlation between TSec ­ an average annual growth rate of the market yield on U.S. Treasury securities at 1-year constant maturity ­ and ()-(GDP) over 1960-2009. ... Correlation between ()-(GDP) and the yields spread became...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description
• SAI Open Star Clusters (SAI OCL) Catalog

Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

• Imaging lab: people

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>263) - kinfo.ru/ )

• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• Complete Savages - Фильмы - Kinfo.ru
• When Strangers Appear - Фильмы - Kinfo.ru

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>148) - genphys.phys.msu.su/ )

• Active To Do List

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Main Science and education Scientific Laboratories Laboratory of nonlinear polarization optics . ... The mechanisms of evolution of polarization during radiation propagation in nonlinear media with nonlocality of optical response. ... As a result, a new field of science has originated, the nonlinear polarization optics, providing new insights into the interplay of polarization effects in classic nonlinear optical processes. ...

Еще в разделе: (Показать все результаты (>266) - ofvp.phys.msu.ru/ )

• Публикация
• Publication
• Семинар кафедры ОФиВП и МЛЦ

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>72) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/LasPhys-2001-11(12)-en.pdf
• http://qilab.phys.msu.ru/papers/LasPhys10_03GrishaninLO.pdf
• http://qilab.phys.msu.ru/papers/VMU-No.%205,%20pp.%20315-320%20(2008)-EN.pdf

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>18) - www.kge.msu.ru/ )

... New Approach to the Defibrillation Problem: Suppression of the Spiral Wave Activity of Cardiac Tissue A. Yu. ... It is shown that a weak external point action on such a medium leads to the suppression of all spiral waves and, correspondingly, to the stabilization of the system dynamics. ... Thus, the most favorable frequencies for suppression are external-action frequencies at which the frequency of circular waves excited by them is close to the maximum possible value for given medium parameters. ...

Еще в разделе: (Показать все результаты (>66) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/PHDK634.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/TDB_Loskutov_Leonel.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JPA_DLA_2007.pdf