... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>147) - www.genebee.msu.ru/ )

• GEA :: Gene Expression Analysis
• DIMACS Series in Discrete Mathematics
• OUTPUT

... Consequently, weak fluctuations of the 1 growth rate concerning the M growth rate must necessarily generate strong fluctuations of the 2 growth rate. ... Statistics show that financial shocks occurred at positive values of ()(GDP). ... To test our hypothesis we consider correlation between TSec ­ an average annual growth rate of the market yield on U.S. Treasury securities at 1-year constant maturity ­ and ()-(GDP) over 1960-2009. ... Correlation between ()-(GDP) and the yields spread became...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

... Karlsruhe Institute of Technology (KIT) . 76021 Karlsruhe/Germany . ... Most technological applications of crystalline materials are based on the modification of their microstructure (e.g. of their grain size and/or of the topology of different phases that may be present). ... Glasses with this microstructure will be called poly-glasses in analogy to poly-crystals). ... Professor , Institute of Materials Science, University . ... Founding Director and Senior Member of the Institute of New . ...

Еще в разделе: (Показать все результаты (>139) - www.chem.msu.ru/ )

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>41) - smdc.sinp.msu.ru/ )

• Prognos-9 - Space monitoring data center
• NUCLEON Experiment
• Solar flares - Space monitoring data center

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: that may generate a peril on your own sig . ... Now a day's sunglasses are practically anyone sensible oakley radar sizes setting up block on the planet. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>2624) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Generate More Sales With One Of
• Экологический Форум - Фундаментальная Экология: Suggestions For Generating The
• Экологический Форум - Фундаментальная Экология: held and Generation year,

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofљ the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• Outreach | Университетский спутник "Ломоносов"
• IMISS-1 | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

... Program of the Course of Radio Astronomy . Moscow State University , Physics Department , Astronomy Division , 4 th year, 60 hours in total) . ... Molecular maser emission. ... The emission of the interstellar neutral hydrogen. ... Pacholczyk, A. G. Radio Astrophysics, W. H. Freeman & Co., ... Frontiers of Astrophysics, Avrett, E. H., ed., Harvard University Press, Cambridge, Mass., ... Kaplan, S. A., Pikelner, S. B. The Interstellar Medium, Harvard University Press, Cambridge, Mass., ...

Еще в разделе: (Показать все результаты (>55) - comet.sai.msu.ru/ )

• Astronomical Circular - Contents
• Using MicroEMACS commands
• Multiwavelength Study of Mira Ceti-Type Variable Stars

.

Еще в разделе: (Показать все результаты (>52) - www.chemport.ru/ )

• Ukrainian power generation 1.рынок электроэнергии рф электроэнергетика украины

.

Еще в разделе: (Показать все результаты (>4) - www.hist.msu.ru/ )

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

• Solar Physics Department

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

• People
• Research Interests

... Специальный выпуск. 16 ноября 2010 г. ------------- 11 ноября 2010 года была опубликована 36-ая редакция списка 500 наиболее мощных компьютеров мира Top500. ... На 17-ое место списка с 13-го переместился суперкомпьютер МГУ Ломоносов производства компании Т-Платформы , установленный в Научно-исследовательском вычислительном центре МГУ имени М.В.Ломоносова, с пиковой производительностью 414.42 TFlop/s и производительностью на тесте Linpack 350.1 TFlop/s. На 62-ое место с 46-го опустился...

Еще в разделе: (Показать все результаты (>95) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]
• PARALLEL.RU - Новости, специальный выпуск [02/06/2010]
• PARALLEL.RU - Новости, выпуск #329 [10/07/2012]

Materials Science in Semiconductor Processing 4 ( 2001 ) 51-53 Probe of the vicinal Siр111Ю surface by second harmonic phase spectroscopy D. Schuhmachera,*, G. Marowskya, A.A. Fedyaninb, T.V. Dolgovab, O.A. Aktsipetrovb a Laser-Laboratorium Gottingen e ... 1, 37077 Gottingen, Germany Е Е b Department of Physics, Moscow State University, 119899 Moscow, Russia Abstract The intrinsic surface sensitive technique of optical second harmonic (SH) phase and ... 2001 Elsevier Science Ltd. ...

Еще в разделе: (Показать все результаты (>35) - shg.phys.msu.ru/ )

• List of selected publications

... A new data acquisition system was implemented to allow us to handle the high data rates produced by the multiple triggers. ... The LGD system includes the 9 ton glass array of 4 cm x 4 cm x 45 cm blocks, a transporter capable of placing each module in an electron beam for calibration and a monitoring system. ... A unique feature of E852 is the ability to make a trigger decision based on either the total energy or the effective mass of a system of photons. ... First, the energy cluster must be narrow...

Еще в разделе: (Показать все результаты (>69) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/3pi0.ps
• http://lav01.sinp.msu.ru/nir/papers/NIM_CsI-D.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/Porteboeuf-Houssais_AFTER_Mai2012_AMPT.pdf

... Associating polyelectrolytes are macromolecules consisting of soluble charged groups and insoluble groups (stickers) distributed along the chain. ... 1] I.I. Potemkin, V.V. Vasilevskaya, A.R. Khokhlov, " Associating polyelectrolytes: Finite size cluster stabilization versus physical gel formation ", . ... 12] N.N. Oskolkov, I.I. Potemkin, " Complexation in asymmetric solutions of oppositely charged polyelectrolytes: Phase diagram ", Macromolecules 2007 , 40 , 8423-8429 . ... PSMTLab . ...

Еще в разделе: (Показать все результаты (>206) - polly.phys.msu.ru/ )

• Selected publications of Muzafarov, Aziz Mansurovich

... Monitoring of population of rare orchid Epipogium aphyllum (F.W. Schmidt) Sw. on the isl. ... We counted generative shoots and flowers on them; we also checked the presence of pollinia in all flowers. We fixed four damaged by animals inflorescences (one flower, two flowers and two inflorescences with three flowers) with 70% ethanol to estimate the potential seed production. ... In the groups of generative shoots only one rhizome gave rise to the two generative shoots. ...

Еще в разделе: (Показать все результаты (>6103) - herba.msu.ru/ )

• The employment of quantitative methods for the lake ecosystem research
• Population of Epipogium aphyllum on the Kem’-Ludskij archipelago (White Sea)
• The flower organ transition in water-lily

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>11) - lmmqsp.sinp.msu.ru/ )

... The system is organized as a mixture of two methods: concatenation - on the segment level (using the linguistically motivated units - allophones spliced together to form the synthesized speech wave) and the rule-based method on the prosodic level to modify speech wave created from the allophones according to the prosodic characteristics of the phrase being synthesized. ... Our system takes as an input text any sequence of orthographic words separated by gaps or punctuation marks. ...

Еще в разделе: (Показать все результаты (>170) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/SpeechGroup/publication1/bab_kr_00.doc
• Department for Discourse and Communication Studies

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>44) - new.math.msu.su/ )

• http://new.math.msu.su/department/opu/sites/default/files/attached_files/protasov_grigoriev_zapletin_extern.pdf
• http://new.math.msu.su/department/opu/sites/default/files/attached_files/tikhomirov_fursikov_extern.pdf

... Форумы > Разное > Тема . ... Состоялся финал международной студенческой конференции 'IT Security for the Next Generation'. Состоялся финал международной студенческой конференции 'IT Security for the Next Generation '. 13-15 апреля в Мюнхене состоялся финал международной студенческой конференции 'IT Security for the Next Generation ', который объединил победителей всех 3-х региональных отборочных туров (Европейского, Азиатско-Тихоокеанического региона, Ближнего ...

Еще в разделе: (Показать все результаты (>61) - www.mmonline.ru/ )

• Математический семинар Глобус 17 июня
• MMOnline | Форумы | Разное
• MMOnline | Новости