... Version 2.0 modifies version 1.8 to include explicit statistical estimates for similarity scores based on the extreme value distribution. ... TFASTA with ktup=2 is about as fast as a DNA FASTA with ktup=4, and is substantially more sensitive. (also reads the GENBANK library) TFASTX Search DNA library for a protein sequence by translating the DNA sequence to protein in all six frames (three forward frames with the -3 command line option) calculating similarity scores that allow frameshifts. ...

Еще в разделе: (Показать все результаты (>162) - www.genebee.msu.ru/ )

• BLAST Basic Overview
• Laboratory of protein-nucleic interactions (Russian version)
• Selected Scientific Journals - How to link to us

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Alexander V. Tikhonravov, Tatiana V. Amotchkina, Michael K. Trubetskov, Robert J. Francis, Vesna Janicki, Jordi Sancho-Parramon, Hrvoje Zorc, and Vladimir Pervak, "Optical characterization and reverse engineering based on multiangle spectroscopy," Appl. ... 51, 245-254 (2012) . We perform characterization of thin films and reverse engineering of multilayer coatings on the basis of multiangle spectral photometric data provided by a new advanced spectrophotometer accessory. ...

Еще в разделе: (Показать все результаты (>104) - srcc.msu.ru/ )

• Tatiana V. Amotchkina, Michael K. Trubetskov, Vladimir Pervak, Boris Romanov,

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>103) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова

... Here, we present a systematic analysis of respiration genes encoded by the genomes of human gut habitants. Our study included an analysis of genes for ATP synthases, respiratory reductases for electron acceptors, and quinone biosynthesis. ... During the analysis of anaerobic respiration in the human gut reference genomes, we found that certain studied genomes did not contain the full set of respiratory enzymes for the reduction of nitrate to ammonia or molecular nitrogen. ...

Еще в разделе: (Показать все результаты (>247) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/5.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/209.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf

English version] [Pyc.- ... The laboratory was founded in 1991, when Cellulase Research Group at the Division of Chemical Enzymology, M.V.Lomonosov Moscow State University, received the status of laboratory. From the moment of establishment of the Division of Chemical Enzymology in 1974 by Professor Ilya Berezin, Cellulase Research Group was led by Dr. Anatole Klyosov. ... Enzymology, biochemistry and biotechnology of enzymes catalyzing the biodegradation of polysaccharides: . ...

Еще в разделе: (Показать все результаты (>142) - www.enzyme.chem.msu.ru/ )

• Cellulase lab Russian version
• PubMed medline query

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

Еще в разделе: (Показать все результаты (>2) - parcon.parallel.ru/ )

This file is an archive of all of the changes which have been made to the Bright Supernovae pages in 1998 (which is when I started logging them). ... Added images from this page to the 1997cw and 1997cx entries. ... Added several images to the 1996 SN , 1997 SN , 1998 SN , 1998S , and 1998eg pages from "The Astronomer" mag Variables, Novae and Supernovae Images page. ... Added images to the 1998aq , 1998S , 1998bu , and 1998es web pages from a list of images on Laszlo Kiss's Latest images web page. ...

Еще в разделе: (Показать все результаты (>153) - www.rochesterastronomy.org/ )

• Bright Supernova Bright Supernova
• Supernova 2001X in NGC 5921
• Supernova 2001V in NGC 3987

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>5) - lcc.chem.msu.ru/ )

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Ideal candidate's profile: Higher education majoring in Information Technologies, Working level of English (both oral and written), Strong PC skills, Fluent English, Strong analytical skills, accuracy, high level of responsibility. ... Daily review of network security, with details related to creation/activation/deletion/change of user ID's; . ... Quarterly review of server Directory structure and Network permissions check; . ...

Еще в разделе: (Показать все результаты (>79) - www.physcareer.ru/ )

• Summer Internship Program with The Nielsen Company / Стажировки / Physcareer.ru

... Дайджест психологических исследований . ... применение тестов математические методы в психологии анализ и визуализация данных результаты выборов математические методы наука юмор организационная психология диссертация hr выборы диссертации эксперименты геолокация опросы ссылки профессии мотивация психодиагностика MS Excel онлайн-сервисы SEM ubuntu психологические журналы R IBM SPSS Statistics фото SPSS рецензии онлайн исследования структурное моделирование анализ данных регрессионный ...

Еще в разделе: (Показать все результаты (>171) - tukachev.flogiston.ru/ )

• Tag: SPSS Evaluation Version
• Tag: SEM
• Tag: AMOS

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Opening of the educational programme - School of CEOs, "Capsule of security"
• Admission committee | MSU Higher school of management and innovation

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>19) - lcl.srcc.msu.ru/ )

Dmitriy Mendeleev . ... Dmitry Ivanovich Mendeleev : A project of undergraduate students from School No.470 (St.Petersburg) . ... Brokhaus Online: Biography of Mendeleev in Russian . ... Original Periodic Table by Mendeleev . ... Mendeleev's "Principles of Chemistry" (4 Pts. in 2 Vols) . ... Mendeleev's house museum in the village Boblovo, Moscow region (in Russian) . Statue of Mendeleev in front of Chemistry Department at Moscow State University (from the article about Russian chemistry in Chem. ...

Еще в разделе: (Показать все результаты (>149) - www.chem.msu.ru/ )

• Слайд PPT

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . ... Вся правда о серверах . ... O'Rey . Mar 23 2007, 17:36 . Сообщение #1 . ... Наконец-то стало достоверно известно, кто же именно сломал сервер. ... Apr 4 2007, 11:12 . ... Цитата(O'Rey @ Apr 4 2007, 12:12) . ... Но сервер пингуеццо. ... Предыдущая тема Общение Следующая тема . ... Танцевальная жизнь Общение |- Общение |- ... Подписка на тему Сообщить другу Версия для печати Подписка на этот форум . ...

Еще в разделе: (Показать все результаты (>933) - grace.msu.ru/ )

• Вестник тирании - Грация-МГУ::Форум
• Плохой день - Грация-МГУ::Форум
• Вся правда про белку - Грация-МГУ::Форум

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>6) - sparallel.ru/ )

• sparallel.ru - Part 106
• Jook обувь | sparallel.ru

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>55) - www.socio.msu.ru/ )

• Вестник МГУ
• Главная - Социологический факультет МГУ

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>88) - cosmos.msu.ru/ )

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

100. http://erg.biophys.msu.ru/tpp/