Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:41:56 Tue, 07 Dec 2010 11:14:03 GMT Ilia [55:bf831181327c] * Interface.py ( modified ) make of window Tue, 07 Dec 2010 00:03:18 GMT is_rusinov [54:cd1c0983d3b6] * Interface.py ( modified ) mouse handlers, change state, still there are mistakes in these methods Mon, 06 Dec 2010 14:50:23 GMT is_rusinov [53:be7479f995a8] * Interface.py ( ...

Еще в разделе: (Показать все результаты (>418) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=54%3Acd1c0983d3b6&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=55%3Abf831181327c&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=cd1c0983d3b6675604e04040af0662f3d06d8ece&limit=100&mode=stop_on_copy

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• Photo-induced delayed luminescence

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Koronovsky_etal_2015_eng.pdf

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>17) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>3) - elast.math.msu.su/ )

Home People Activities Research Publications . ... Research problems for students . ... Technische Universiteit Eindhoven: BioMedical Image Analysis: http://w3.bmt.tue.nl/en/research/divisions_bme/biomedical_imaging_modeling/biomedical_image_analysis/ . ... Technische Universiteit Eindhoven: Luc Florack: http://w3.bmt.tue.nl/en/peoplebme/?no_cache=1 =showemp.php =1033 . ... Vision Research Lab - Publications (University California Santa Barbara): http://vision.ece.ucsb.edu/publications/ . ...

Еще в разделе: (Показать все результаты (>19) - imaging.cs.msu.ru/ )

Sample Submission Form for Example Measurements In order to provide the best and most appropriate measurement/results, the customer is asked to please fill in the following form and enclose it with the sample. This form or equivalent information is required prior to the sample measurements. ... WITec can not provide specialised sample preparation. Measurement Goal: What's the goal of the measurement? ...

Еще в разделе: (Показать все результаты (>11) - nano.msu.ru/ )

• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Source URL: http://ani.cs.msu.su/en/node . ... 8] http://ani.cmc.msu.ru/files/Расписание лекций консультаций 2015 (2).xls . ... 12] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (бПМиИ).doc . 13] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (спец.).doc . 14] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (бПМиИ).doc . 15] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (спец.).doc . ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

• Courses
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>20) - io.cmc.msu.ru/ )

. # ....... # S ....... S T ..... E R . Q U E . C N ..... T C ....... U # ....... R E ..... E S . S .

Еще в разделе: (Показать все результаты (>5) - mouse.belozersky.msu.ru/ )

• NPG-explorer

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>208) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

... On Wednesday, July 3rd, the Faculty of Physics will conduct a seminar (room H8) where we will discuss the following topics? ... 1) MEMS technology. ... MEMS circuits that are currently made. ... 2) Renesas microcontrollers. ... 4) Power source circuits ST (AC-DC). ...

Еще в разделе: (Показать все результаты (>28) - engineering.phys.msu.ru/ )

• Microcontroller Programming
• Parallel Programming
• A news section started

. JCatalog | Start | Links .

Еще в разделе: (Показать все результаты (>177) - journals.genebee.msu.ru/ )

• JCatalog journal list

... Parsimony method . ... It is based on the following principle: the ancestral sequences (posed in nodes of a phylogenetic tree) should be such that the minimal required number of character replacements on the branches of the tree is less than for any other choice of sequences. ... If the preliminary character of the node is * , but the output character of its immediate ancestor is some letter (say, X ), and its set of possible characters contains X , then the output character of the node is also X . ...

Еще в разделе: (Показать все результаты (>44) - monkey.belozersky.msu.ru/ )

• Inquiry information || Rule of four sequences
• Homeodomain numeration assumed
• ETS_3D_conservation

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

Setting Up a Pay System Canada Business Service Centres - CBSCs Last Verified: 2004-05-28 Document No. 4046 Summary Pay administration is a management tool that enables you to control personnel cost, increase employee morale, and reduce work force turnover. ... This publication provides time-tested concepts for determining competitive pay levels and for maintaining fair pay relationships among the jobs comprising a small company. ... appraise employee performance under the plan. ... job title; . ...

Еще в разделе: (Показать все результаты (>19) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>53) - eng.geogr.msu.ru/ )

• Departments
• Elbrus teaching and research station
• Selenga-Baikal research

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )