... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>2) - vestnik.math.msu.su/ )

... Published: 24 October 2013 . ... A Science Festival took place in Moscow in October 11-13. ... Among a variety of projects one could find already known robots and absolutely new ones. ... At the same time, not so far away, LIDAR was scanning the surrounding objects and was building a base map. ... While the robots were recharging, we did our best entertaining the audience with the liquid nitrogen showing all sorts of tricks and destroying myths of the film ?Terminator?. ...

Еще в разделе: (Показать все результаты (>3) - engineering.phys.msu.ru/ )

Влияние отношений внутри социальных групп на отношение их членов к экологии. ... В данной статье исследуется вопрос о том, как отношения внутри социумов влияют на отношение людей этих сообществ к экологии. В работе используются репрезентативные данные из национальных источников (США). В частности исследуются модели поведения в замкнутых группах, в которых описываются характер связей между участниками данных сообществ, включая их семейные связи, отношения с соседями и с коллегами. ...

Еще в разделе: (Показать все результаты (>5) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=1&subtheme=23&from=0&ref_ind=1020004054
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=3&subtheme=35&from=&ref_ind=0202004176

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Nonlinear wave dispersion in the particle method for incompressible fluid" . Nekrasova T.I., Frank A.M. In the framework of the particle method for incompressible fluid, a dispersion relation for linear surface waves is obtained. ... A comparison with some other numerical methods for free surface flows is performed from the standpoint of accuracy of wave dispersion simulation. Keywords: linear waves, dispersion, particle method . PostScript (in Russian) (11.5MB) . ...

Еще в разделе: (Показать все результаты (>3) - num-meth.srcc.msu.ru/ )

... Abbott Larry Dept of Geography University of Illinois lrabbott@net66.com 310 Greenview Drive #2 Urbana IL 61801 USA [4,10] . ... Almond Peter Soil Science Department Lincoln University PO BOX 84 Canterbury New Zealand . ... Buck Brenda J. Dept. ... Buurman Peter Dept of Soil Science & Geology Agricultural University PO Box 37 6700 AA Wageningen The Netherlands . ... Miedema R. Dept of Soil Science & Geology Agricultural University Rienk.Miedema@bodeco.beng.wau.nl PO BOX 37 Wageningen The Netherlands...

Еще в разделе: (Показать все результаты (>2) - www.paleopedology.msu.ru/ )

• Commission on Paleopedology Discussions

The Linux System Administrators' Guide . ... This manual, the Linux System Administrators' Guide, describes the system administration aspects of using Linux. It is intended for people who know next to nothing about system administration (as in ``what is it?''), but who have already mastered at least the basics of normal usage. ... See below for more information about Linux manuals. ... Plenty of the rest of the Linux documentation is also important for system administrators. ...

Еще в разделе: (Показать все результаты (>11) - itpm.msu.su/ )

• ЗЮБзЦФРЯ - Apache HTTP Server

TWiki (TM) was written by Peter Thoeny, based on parts of Ward Cunningham's original Wiki and Jos Wiki, and has been further developed by Peter and other TWiki contributors. ... This document identifies these people as authors of TWiki. ... TWiki:Main.AdamTheo | USA | ... TWiki:Main.AdrianLynch | Australia | ... TWiki:Main.AlWilliams | ... Russia | ... Italy | ... Germany | ... Canada | ... Brazil | ... http://c-dot.co.uk | ... Markus Peter | ... http://www.structuredwikis.com/peter | ...

Еще в разделе: (Показать все результаты (>4904) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (1 vs. 2) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• %TOPICTITLE% (10 vs. 11) - TWiki

The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...

Еще в разделе: (Показать все результаты (>5) - old.philol.msu.ru/ )

• МГУ-ЛОКЛЛ:: Библиография основных работ А.А. Поликарпова за последние годы
• Using Markov Chains for Identification of Writers
• MSU-LGCLL:: Curriculum Vitae of Anatoliy Anatolyevich Polikarpov

Analytical chemistry departmemt . Electrochemistry methods laboratory . ... Dissertation scientific councils MSU . ... Occupation: Professor of M.V. Lomonosov Moscow State University (MSU), Head of Electrochemistry methods lab., ... 2010-2014 Associate Editor Electroanalysis (Wiley-VCH) . ... 2014: International Society of Electrochemistry Fellow. ... 2008: Bronze statuette 'Saint George' - Prize of the IX International Forum 'High Tech of XXI century' . 2008: Medal '50 years VOIR'. ...

Еще в разделе: (Показать все результаты (>3) - analyt.chem.msu.ru/ )

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... Конкурс-конференция на получение премии поддержки молодых ученых. ... Главная О МЛЦ МГУ Фотогалерея Конференция ICONO/LAT 2005 . ... на весь экран . 26.01.2009 . ... 23.05.2005 . ... Переговоры на конференции: зам. декана физического факультета МГУ П.К. Кашкаров и директор ИПЛИТ РАН В.Я. Панченко. iconolat05_110505_035.jpg . ... Торжественное открытие конференции ICONO 2005. ... Регистрация участников конференции. ...

Еще в разделе: (Показать все результаты (>10) - ilc.phys.msu.ru/ )

• Альбомы

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [16/11/2010] . ... Выпуск 298 . 23 ноября 2010 г. ------------- 1 декабря 2010 заканчивается срок представления аннотаций докладов на Международную научную конференцию Параллельные вычислительные технологии (ПаВТ) 2011 . http ://agora.guru.ru/pavt ------------- На странице Научного семинара PARALLEL.RU выложены ссылки на видеозапись выступления Томаса Стерлинга в НИВЦ МГУ имени М.В.Ломоносова 1 ноября 2010 года ...

Еще в разделе: (Показать все результаты (>2) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]

... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Конференции: Календарь / Материалы . ... Геология >> Геофизика | Анонсы конференций . ... 13.10.2003 | А.Б. Кирмасов . РОССИЙСКАЯ АКАДЕМИЯ НАУК КАРЕЛЬСКИЙ НАУЧНЫЙ ЦЕНТР ИНСТИТУТ ГЕОЛОГИИ Петрозаводск, 1317 октября 2003 XIV Молодежная научная конференция, посвященная памяти члена-корреспондента АН СССР К.О.Кратца "ГЕОЛОГИЯ И ГЕОЭКОЛОГИЯ СЕВЕРО-ЗАПАДА РОССИИ" ПЕРВЫЙ . ... Тематика совещания: Геология и . ...

Еще в разделе: (Показать все результаты (>10) - phys.web.ru/ )

• Все о геологии :: Анонсы конференций - Геохимические науки ()
• Все о геологии :: Анонсы конференций - Петрология ()
• Все о геологии :: Анонсы конференций - Геотектоника ()

sparallel.ru . Обувь париж кемерово . Туфли детские для девочек на каблуках . ... Материал подкладки: ворсин (полиэстер-100%) Материал подошвы: резина (100%) Материал стельки: ворсин (полиэстер-100%). ... С помощью такой экстравагантной обуви, как эти ботинки, Вы создадите уверенный, беспроигрышный образ каждый день. ... Мужские кроссовки ? фото кроссовки lanvin, цена 21529 руб мужские кеды ? ... кеды lanvin. ... Мужские кеды дольче габбана . Кеды гесс . ... Детские кеды gucci . ...

Еще в разделе: (Показать все результаты (>4) - sparallel.ru/ )

• Skechers сланцы | sparallel.ru
• Barrats обувь | sparallel.ru
• Luis david обувь | sparallel.ru

The Department of Talented Youth Affairs and Professional Orientation . ... Projects . ... From 1 to 6 July 2014 there were held the third championship of the ?SanSat in Russia? which took place in Dubna (Moscow) ? ... CanSat is a model of microsatellite weighing about 350 grams. CanSat project started in 1999. ... Participants at the third championship were offered a large educational and excursion programs. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>2) - talant.msu.ru/ )

• International Student Olympiad in Iran | The Department of Talented Youth

... of engineering and ecological geology . Scientific staff-members . Staff of Department . Staff of Soilscience laboratory . ... Head of Laboratory . ... Doctor of geological-mineralogical science, . ... Laboratory жб -06 . ... Phone: 939-34-69 . ... Senior staff scientist . ... PhD, candidate of geological-mineralogical science . ... Rock test? . ... PhD, candidate of physics-mathematical science . ... Staff scientist . ... Soil test Laboratory? . ... Principal engineer . ...

97. MsuNews.Ru | Новости МГУ | Нобелевский лауреат Джордж Смут получил грант

98. Neutron scattering and diffraction investigations of proton glass state in

99. http://qi.phys.msu.ru/papers/2010-nphoton-4-585.pdf

100. Разбор древненримского паралеллизма