... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>53) - biochem.bio.msu.ru/ )

• Structure and properties of chimeric small heat shock proteins containing
• Cardioprotective effect of histidine-containing dipeptides in pharmacological
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

DEADLINE: Tuesday, February 1, 2005 I. Program Overview The ECA Alumni Small Grants Program (ASGP) is a professional and community development program open to alumni of the following ECA-sponsored exchange programs: the Contemporary Issues Fellowship Program (CI), the FREEDOM Support Act Undergraduate Program (FSAU), the Regional Scholars Exchange Program (RSEP) and the Russian-US Young Leadership Fellows for Public Service Program (YLF.) ... 2005 ECA Alumni Small Grants Program [pic] ...

Еще в разделе: (Показать все результаты (>72) - www.prof.msu.ru/ )

• Short questionnaire
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS
• INTERNET RESOURCE LIST

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>97) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf
• http://qfthep.sinp.msu.ru/talks/2010_09_14_Perfilov_FCNC1.pdf

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>11) - new.choir.msu.ru/ )

• Concerts | Academic choir of Moscow State University
• Conductor | Academic choir of Moscow State University
• Contacts | Academic choir of Moscow State University

... General Catalog of Variable Stars (GCVS database, Version 2012 Feb.) ... The cross-identification tables of the General Catalogue of Variable Stars (GCVS) contain all GCVS (including extragalactic variables from vol.V), NSV (New catalogue of Suspected Variable stars) and Supplement to the NSV stars as well as stars from the name-lists of variable stars nos. 67 - 80; it also makes it possible to find out identifications between the GCVS and the NSV catalogue. ... I-III) names are included. ...

Еще в разделе: (Показать все результаты (>77) - sai.msu.ru/ )

• GCVS Query forms
• Index of /groups/cluster/gcvs/gcvs/nsv
• Index of /groups/cluster/gcvs/gcvs/iii

... Available trees in the HiForest : hiEvtAnalyzer/HiTree - Event property tree. ... Pb-Pb (2.76 TeV): /eos/ cms /store/group/phys_heavyions/icali/MinBias_Merged.root ( https ://twiki.cern.ch/twiki/ bin /viewauth/ CMS /HiForest#Data ) P-Pb (run 202792): /afs/cern.ch/user/t/tuos/work/public/pPb/Data/ PAPhysics-pt01-full_WithCentrality.root ( https ://twiki.cern.ch/twiki/ bin /viewauth/ CMS /PPbCentralityAna , https ://twiki.cern.ch/twiki/ bin /viewauth/ ...

Еще в разделе: (Показать все результаты (>35) - lav01.sinp.msu.ru/ )

... Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by molecular mechanics using a force field based on the Gillespie-Kepert model . ... Abstract - A new approach combining the molecular mechanics (MM) method and the Gillespie- Kepert model was applied to calculate the geometry and strain energy of zinc(II) and cadmium(II) complexes with amino- and pyridyl-containing ligands. ...

Еще в разделе: (Показать все результаты (>27) - analyt.chem.msu.ru/ )

• Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>5) - www.students.chemport.ru/ )

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Department of Biogeography
• Department of Geography of World Economy
• Department of Social-Economic Geography of Foreign Countries

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>108) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение толщины пластин

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt