Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>42) - hea.phys.msu.su/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>195) - www.kosmofizika.ru/ )

• Coordinate Systems
• Index of /lazutin

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt

... Микс 193 A 131 A 171 A 211 A 304 A Корона Магнитограмма . 211 + 193 + 171 . Description . ... LASCO (Large Angle and Spectrometric Coronagraph)- инструмент на космическом аппарате SOHO, поставляющий изображения солнечной короны, на которых свет, идущий непосредственно от Солнца, заблокирован с помощью искусственного затмения, создаваемого самим аппаратом. ... The form and the location of the magnetospheric boundary are defined by pressure balance of the solar wind and geomagnetic field. ...

Еще в разделе: (Показать все результаты (>1230) - swx.sinp.msu.ru/ )

Microsymposium 34, MS015, 2001 TO THE DISCOVERY OF THE "SOUTH POLE - AITKEN " BASIN. ... Head [2] and Spudis [1] suggested in their reviews that the existense of the structure identified later as the South Pole - Aitken baasin was first predicted on the basis of a relief analysis of the mountain ridges observed in the libration zone be Hartman and Kuiper [7], i.e. after the first images of the lunar far-side had been obtained. ... SOUTH POLE-AIKEN BASIN: V.I.Chikmachev et al. ...

Еще в разделе: (Показать все результаты (>52) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• Yurii Naumovich Lipsky

Кафедра Общей Физики и Волновых Процессов . физического факультета МГУ . Главная . ... О Кафедре . Наука и учеба . ... Публикации . Лаборатории . ... Наука . ... 18.03.2016 . Открыт прием заявок на участие студентов в Универсиаде "Ломоносов" . ... Главная Наука и учеба Публикации . ... Chesnokov S.S., Kaptsov L.N., Samarkin V.V., Kudryashov A.V. Лаборатории: Лаборатория вычислительного эксперимента в оптике . ... 2009 Кафедра ОФиВП, физический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>44) - ofvp.phys.msu.ru/ )

• Publication

An Evolving Algebra Approach to Formal Description of one class of Automata Networks V. M. Severyanov 1 Laboratory of Information Technologies Joint Institute for Nuclear Research 141980 Dubna, Moscow region, Russia Abstract The Automata Networks considered here and called Hyperbolic Cellu­ lar Automata are based on Iterated Function Systems and originally were designed for constructing fractal objects. ... C is a set of cells; . ... System states are represented here as static algebras. ...

Еще в разделе: (Показать все результаты (>46) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ohl/acat2002.pdf
• http://acat02.sinp.msu.ru/presentations/ratnikova/01.pdf
• http://acat02.sinp.msu.ru/form/hotel_form.doc

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>126) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

European Treaty Series - No. 165 CONVENTION ON THE RECOGNITION OF QUALIFICATIONS CONCERNING HIGHER EDUCATION IN THE EUROPEAN REGION Lisbon, 11.IV.1997 2 ETS 165 ­ Recognition Qualifications Higher Education in the European Region , 11.IV.1997 The Parties to this Convention , Conscious of the fact that the right to education is a human right, and that higher ... 3 6 ETS 165 ­ Recognition Qualifications Higher Education in the European Region, 11.IV.1997 Section III. ...

Еще в разделе: (Показать все результаты (>35) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/11.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

О лаборатории . ... Лаборатория теоретической биофизики . ... On this page we collect references to our resources, documentation and resources on other sites. All these data are very helpful for everybody who wants to learn practical quantum chemistry. Firefly (PC GAMESS) main page . ... ERG group wrote some articles about visualization: . ... Нет комментариев " Quantum chemistry information page " . ... Quantum chemistry information page . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>55) - erg.biophys.msu.ru/ )

• GAMESS ERG Research Group: Лаборатория теоретической биофизики
• toolset ERG Research Group: Лаборатория теоретической биофизики
• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики

.

Еще в разделе: (Показать все результаты (>228) - geo.web.ru/ )

• Comagmat software
• Все о геологии :: ChemEl 1.0
• Plechov's FOTOALBUM

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>32) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf
• http://ideas.msu.ru/docs/ERC_rules.pdf
• http://ideas.msu.ru/docs/guideline_third_country.pdf

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>115) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs
• About me
• Seminar in Polymer Physics

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>259) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications
• Laboratory of Ternary Informatics | CMC MSU
• Department of Supercomputers and Quantum Informatics | CMC MSU

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

98. Студенческий форум Физфака МГУ > Software Developer

99. Проблемы с MSDN, что c VS2005 Feb CTP - Public forum of MSU united student

100. OS/2 Клиент в сети Microsoft